After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Macaque de Buffon NNAT/Neuronatin expression plasmide de Gène l'ADNc ORF clone, C-HA Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Cynomolgus NNAT Informations sur les produits clonés de cDNA
Gene_bank_ref_id:XM_005568966.1
Taille du ADNc:165bp
Description du ADNc:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) neuronatin with C terminal HA tag.
Synonyme du gène:NNAT
Espèces:Cynomolgus
Vecteur:pCMV3-C-HA
Plasmid:
Site de restriction:
Séquence du marqueur:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Description de la séquence:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Macaque de Buffon NNAT/Neuronatin expression plasmide de Gène l'ADNc ORF clone, C-HA Marqueur on other vectors
Macaque de Buffon NNAT/Neuronatin expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurCG90414-ACGCHF270
Macaque de Buffon NNAT/Neuronatin expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurCG90414-ACRCHF270
Macaque de Buffon NNAT/Neuronatin expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurCG90414-ANGCHF270
Macaque de Buffon NNAT/Neuronatin expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurCG90414-ANRCHF270
Macaque de Buffon NNAT/Neuronatin expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurCG90414-CFCHF230
Macaque de Buffon NNAT/Neuronatin expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurCG90414-CHCHF230
Macaque de Buffon NNAT/Neuronatin expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurCG90414-CMCHF230
Macaque de Buffon NNAT/Neuronatin expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurCG90414-CYCHF230
Macaque de Buffon NNAT/Neuronatin Gène ADNc clone le vecteur de clonageCG90414-GCHF90
Macaque de Buffon NNAT/Neuronatin expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurCG90414-NFCHF230
Macaque de Buffon NNAT/Neuronatin expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurCG90414-NHCHF230
Macaque de Buffon NNAT/Neuronatin expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurCG90414-NMCHF230
Macaque de Buffon NNAT/Neuronatin expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurCG90414-NYCHF230
Macaque de Buffon NNAT/Neuronatin expression plasmide de Gène l'ADNc ORF cloneCG90414-UTCHF230
 En savoir plus sur les vecteurs d'expression
Product nameProduct name
Size / Price
Catalogue : CG90414-CY
Prix catalogue : 
Prix :      (You Save: )
Taille :
Quantité :+-
Disponibilité2-3 weeks
Bulk Discount RequiryAjouter au panier
Contact Us
Images
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »