After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Commande rapide

Text Size:AAA

Rhesus PEMT ORF mammalian expression plasmid, C-His tag

Fiche techniqueCommentairesProduits apparentésProtocoles
Cynomolgus PEMT Informations sur les produits clonés de cDNA
Taille du ADNc:711bp
Description du ADNc:Full length Clone DNA of Macaca mulatta (Rhesus monkey) phosphatidylethanolamine N-methyltransferase with C terminal His tag.
Synonyme du gène:PEMT
Site de restriction:
Séquence du marqueur:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Description de la séquence:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Size / Price
Catalogue : CG90359-CH
Prix catalogue :   (Save )
Prix :      [How to order]
 Instructions d’expédition
      Articles consultés récemment
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.