After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Rhesus RBBP4/RBAP48 expression plasmide de Gène l'ADNc ORF clone

Fiche techniqueCommentairesProduits apparentésProtocoles
Cynomolgus RBBP4 Informations sur les produits clonés de cDNA
Gene_bank_ref_id:NM_001261038.1
Taille du ADNc:1278bp
Description du ADNc:Full length Clone DNA of Macaca mulatta (Rhesus monkey) retinoblastoma binding protein 4.
Synonyme du gène:RBBP4
Espèces:Rhesus
Vecteur:pCMV3-untagged
Plasmid:
Site de restriction:
Séquence du marqueur:
Description de la séquence:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Fond

Histone-binding protein RBBP4, also known as Retinoblastoma-binding protein 4, Retinoblastoma-binding protein p48, Chromatin assembly factor 1 subunit C, Chromatin assembly factor I p48 subunit, Nucleosome-remodeling factor subunit RBAP48 and RBBP4, is a nucleus protein which belongs to the WD repeat RBAP46/RBAP48/MSI1 family. RBBP4 is a core histone-binding subunit that may target chromatin assembly factors, chromatin remodeling factors and histone deacetylases to their histone substrates in a manner that is regulated by nucleosomal DNA. RBBP4 is a component of several complexes which regulate chromatin metabolism. These include the chromatin assembly factor 1 (CAF-1) complex, which is required for chromatin assembly following DNA replication and DNA repair; the core histone deacetylase (HDAC) complex, which promotes histone deacetylation and consequent transcriptional repression; the nucleosome remodeling and histone deacetylase complex (the NuRD complex), which promotes transcriptional repression by histone deacetylation and nucleosome remodeling and the NURF (nucleosome remodeling factor) complex.

One common myth is that age-related memory loss is an early indication of Alzheimer's disease. But researchers at the Columbia University Medical Center in New York City have found a specific protein, RbAp48, that they believe is responsible for age-related memory problems. What's more, by replenishing RbAp48 in the brains of mice, the researchers were able to undo existing age-related memory damage.

To find RbAp48, researchers focused on the hippocampus, the region of the brain where memories are formed. After studying eight healthy brains donated to science by people between the ages of 33 and 88, they found that RbAp48 was reduced by nearly 50 percent in the older brains. The researchers found that when they turned off RbAp48 in younger mice, they became more forgetful, while increasing RbAp48 in older mice restored memory. The mice were given memory tests that included object recognition and water maze problems.

Références
  • Rasmussen HH. et al.,1992, Electrophoresis 13:960-9.
  • Qian Y.-W. et al., 1993,  Nature 364:648-52.
  • Yarden R.I. et al., 1999, Proc. Natl. Acad. Sci. USA. 96: 4983-8.
  • Ota T. et al., 2004, Nat. Genet. 36:40-45.
  • Gauci S. et al., 2009, Anal. Chem. 81:4493-501.
  • Size / Price
    Catalogue : CG90743-UT
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
    Images
        Articles consultés récemment
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »