REG1B cDNA ORF Clone, Rhesus, untagged

Price:
Size:
Number:

REG1B cDNA ORF Clone, Rhesus, untagged: General Information

Gene
Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
501 bp
Description
Full length Clone DNA of Rhesus regenerating islet-derived 1 beta.
Plasmid
Promoter
Enhanced CMV promoter
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

REG1B Background Information

Regenerating gene (Reg), first isolated from a regenerating islet cDNA library, encodes a secretory protein with a growth stimulating effect on pancreatic beta cells, and could be associated with fibrocalculous pancreatopathy. Reg and Reg-related genes which were expressed in various organs have been revealed to constitute a multigene family, the Reg family consisting of four subtypes (types I, II, III, IV) and are involved in cancers and neurodegenerative diseases. Regenerating islet-derived 1 beta (REG1B), also known as Lithostathine-1-beta and Pancreatic stone protein 2 (PSPS2), is a types I Reg protein and contains one typical C-type lectin domain. REG1B is a 166-amino acid protein which has 22 amino acid substitutions in comparison with the previously isolated human REG1A, and it is was expressed only in pancreas. REG1B Is normally found in the exocrine pancreas, whereas in other tissues it appears either only under pathological conditions, such as Alzheimer's disease (brain), cancer (colon), or during regeneration such as neuronal sprouting in brain and pancreas regeneration. REG1B might act as an inhibitor of spontaneous calcium carbonate precipitation. The REG1A and REG1B gene and proteins could play different roles in the pancreas.
Full Name
regenerating islet-derived 1 beta
References
  • Moriizumi S, et al. (1994) Isolation, structural determination and expression of a novel reg gene, human regI beta. Biochim Biophys Acta. 1217(2): 199-202.
  • Sanchez D, et al. (2001) Preferential expression of reg I beta gene in human adult pancreas. Biochem Biophys Res Commun. 284(3): 729-37.
  • Boonyasrisawat W, et al. (2002) Analysis of the reg1alpha and reg1beta gene transcripts in patients with fibrocalculous pancreatopathy. Southeast Asian J Trop Med Public Health. 33(2): 365-72.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait