After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Commande rapide

Text Size:AAA

Rhesus RHEB/RHEB2 expression plasmide de Gène l'ADNc ORF clone

Fiche techniqueCommentairesProduits apparentésProtocoles
Cynomolgus RHEB Informations sur les produits clonés de cDNA
Gene_bank_ref_id:NM_001261182.1
Taille du ADNc:555bp
Description du ADNc:Full length Clone DNA of Macaca mulatta (Rhesus monkey) Ras homolog enriched in brain.
Synonyme du gène:RHEB
Espèces:Rhesus
Vecteur:pCMV3-untagged
Plasmid:
Site de restriction:
Séquence du marqueur:
Description de la séquence:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Fond

RHEB is a recently discovered member of the Ras superfamily that may be involved in neural plasticity. This function is novel and not typically associated with the Ras proteins. RHEB gene is a member of the small GTPase superfamily and encodes a lipid-anchored, cell membrane protein with five repeats of the RAS-related GTP-binding region. RHEB is vital in regulation of growth and cell cycle progression due to its role in the insulin / TOR / S6K signaling pathway. The protein has GTPase activity and shuttles between a GDP-bound form and a GTP-bound form, and farnesylation of RHEB is required for this activity. Three pseudogenes have been mapped, two on chromosome 10 and one on chromosome 22.

Références
  • Karbowniczek, et al. (2004) Regulation of B-Raf kinase activity by tuberin and Rheb is mammalian target of rapamycin (mTOR)-independent. J Biol Chem. 279(29):29930-7.
  • Long, et al. (2005) Rheb binds and regulates the mTOR kinase. Curr Biol. 15(8):702-13.
  • Mizuki N, et al. (1996) Isolation of cDNA and genomic clones of a human Ras-related GTP-binding protein gene and its chromosomal localization to the long arm of chromosome 7, 7q36. Genomics. 34(1):114-8.
  • Size / Price
    Catalogue : CG90714-UT
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »