Commande rapide

Text Size:AAA

Macaque de Buffon SCN2B expression plasmide de Gène l'ADNc ORF clone, C-His Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Cynomolgus SCN2B Informations sur les produits clonés de cDNA
Taille du ADNc:648bp
Description du ADNc:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) sodium channel, voltage-gated, type II, beta subunit with C terminal His tag.
Synonyme du gène:SCN2B
Site de restriction:
Séquence du marqueur:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Description de la séquence:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name

SCN2B plays a key role in the assembly, expression, and functional modulation of the heterotrimeric complex of the sodium channel. Voltage-gated sodium channels (NaV) are composed of one pore-forming alpha-subunit, which may be associated with either one or more beta-subunits. Alpha-subunits are composed for four homologous domains, each of which contains six transmembrane segments.They are responsible for action potential initiation and propagation in excitable cells, including nerve, muscle, and neuroendocrine cell types. SCN2B causes an increase in the plasma membrane surface area and in its folding into microvilli. SCN2B also interacts with TNR and may play a crucial role in clustering and regulation of activity of sodium channels at nodes of ranvier.

  • Kimura K, et al. (2006) Diversification of transcriptional modulation: large-scale identification and characterization of putative alternative promoters of human genes. Genome Res. 16(1):55-65.
  • Tan BH, et al. (2010) Sudden infant death syndrome-associated mutations in the sodium channel beta subunits. Heart Rhythm. 7(6):771-8.
  • Watanabe H, et al. (2009) Mutations in sodium channel beta1- and beta2-subunits associated with atrial fibrillation. Circ Arrhythm Electrophysiol. 2(3):268-75. Kimura K et al., 2006, Genome Res. 16(1):55-65.
  • Size / Price
    Catalogue : CG90365-CH
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
        Articles consultés récemment
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.