APRIL / TNFSF13 cDNA ORF Clone, Rhesus, N-HA tag

Price:
Size:
Number:

APRIL / TNFSF13 cDNA ORF Clone, Rhesus, N-HA tag: General Information

Gene
Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
753 bp
Description
Full length Clone DNA of Rhesus tumor necrosis factor (ligand) superfamily, member 13 with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

APRIL / TNFSF13 Background Information

TNFSF13 is a member of the tumor necrosis factor (TNF) ligand family. It is a ligand for TNFRSF17/BCMA. TNFSF13 is lowly expressed in normal tissues, but is elevated in several types of tumors and transformed cell lines. It is mportant for B cell development. TNFSF13 may also play a role in T-independent type II antigen responses and T cell survival, and induce proliferation/survival of non lymphoid cells. It exists as a functional homotrimer. It can bind to two cell surface receptors, BCMA and TACI, which it shares with BAFF to exert downstream T- and B-cell regulatory effects. TNFSF13 also has been demonstrated to bind to proteoglycans on the cell surface.
Full Name
tumor necrosis factor (ligand) superfamily, member 13
References
  • Bossen C, et al. (2007) BAFF, APRIL and their receptors: structure, function and signaling. Semin. Immunol. 18(5):263-75.
  • Tangye SG, et al. (2007) BAFF, APRIL and human B cell disorders. Immunol. 18(5): 305-17.
  • Osman W, et al. (2012) Association of common variants in TNFRSF13B, TNFSF13, and ANXA3 with serum levels of non-albumin protein and immunoglobulin isotypes in Japanese. PLoS One. 7(4):e32683.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait