Commande rapide

Macaque de Buffon Thrombopoietin/THPO expression plasmide de Gène l'ADNc ORF clone, N-Myc Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Cynomolgus THPO Informations sur les produits clonés de cDNA
Taille du ADNc:1062bp
Description du ADNc:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) thrombopoietin with N terminal Myc tag.
Synonyme du gène:THO, THPO
Site de restriction:
Séquence du marqueur:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Description de la séquence:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Macaque de Buffon Thrombopoietin/THPO expression plasmide de Gène l'ADNc ORF clone, N-Myc Marqueur on other vectors
Product nameProduct name

Thrombopoietin (TPO or THPO), also known as myeloproliferative leukemia virus ligand (c-Mpl), is a hematopoietic growth factor belonging to the EPO/TPO family. The thrombopoietin protein is produced mainly by the liver and the kidney that regulates the production of platelets by the bone marrow. Thrombopoietin protein stimulates both proliferation of progenitor megakaryocytes and their maturation to platelet-producing megakaryocytes, and also accelerates the recovery of platelets. Thrombopoietin protein is involved in cardiovascular disease as it regulates megakaryocyte development and enhances platelet adhesion/aggregation. It has been identified that surface c-MPL, the receptor for thrombopoietin protein, binds to the ligand and mediates the action.

  • Ryu T,et al.(2003) Thrombopoietin-producing hepatocellular carcinoma. Intern Med. 42(8): 730-4.
  • Higashihara M,et al. (2003) Thrombopoietin-producing tumor. Intern Med. 42(8): 632-3?
  • Size / Price
    Catalogue : CG90004-NM
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.