Commande rapide

Macaque de Buffon UBE1 / UBA1 expression plasmide de Gène l'ADNc ORF clone, C-His Marqueur

    Fiche techniqueCommentairesProduits apparentésProtocoles
    Macaque de Buffon UBA1 Informations sur les produits clonés de cDNA
    Gene_bank_ref_id:XM_005593407.1
    Taille du ADNc:3177bp
    Description du ADNc:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) ubiquitin-like modifier activating enzyme 1 with C terminal His tag.
    Synonyme du gène:UBA1
    Espèces:Cynomolgus
    Vecteur:pCMV3-C-His
    Plasmid:
    Site de restriction:
    Séquence du marqueur:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Description de la séquence:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Stockage:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

    Macaque de Buffon UBE1 / UBA1 expression plasmide de Gène l'ADNc ORF clone, C-His Marqueur on other vectors
    Macaque de Buffon UBE1 / UBA1 expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurCG90821-ACGCHF390
    Macaque de Buffon UBE1 / UBA1 expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurCG90821-ACRCHF390
    Macaque de Buffon UBE1 / UBA1 expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurCG90821-ANGCHF390
    Macaque de Buffon UBE1 / UBA1 expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurCG90821-ANRCHF390
    Macaque de Buffon UBE1 / UBA1 expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurCG90821-CFCHF350
    Macaque de Buffon UBE1 / UBA1 expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurCG90821-CHCHF350
    Macaque de Buffon UBE1 / UBA1 expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurCG90821-CMCHF350
    Macaque de Buffon UBE1 / UBA1 expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurCG90821-CYCHF350
    Macaque de Buffon UBE1 / UBA1 Gène ADNc clone le vecteur de clonageCG90821-GCHF90
    Macaque de Buffon UBE1 / UBA1 expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurCG90821-NFCHF350
    Macaque de Buffon UBE1 / UBA1 expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurCG90821-NHCHF350
    Macaque de Buffon UBE1 / UBA1 expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurCG90821-NMCHF350
    Macaque de Buffon UBE1 / UBA1 expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurCG90821-NYCHF350
    Macaque de Buffon UBE1 / UBA1 expression plasmide de Gène l'ADNc ORF cloneCG90821-UTCHF350
     En savoir plus sur les vecteurs d'expression
    Product nameProduct name
    Fond

    UBE1, also known as UBA1, belongs to the ubiquitin-activating E1 family. UBE1 gene complements an X-linked mouse temperature-sensitive defect in DNA synthesis, and thus may function in DNA repair. It is part of a gene cluster on chromosome Xp11.23. UBE1 catalyzes the first step in ubiquitin conjugation to mark cellular proteins for degradation. It also catalyzes the first step in ubiquitin conjugation to mark cellular proteins for degradation by first adenylating its C-terminal glycine residue with ATP, and thereafter linking this residue to the side chain of a cysteine residue in E1, yielding an ubiquitin-E1 thioester and free AMP. Defects in UBA1 can cause spinal muscular atrophy X-linked type 2 (SMAX2), also known as X-linked lethal infantile spinal muscular atrophy, distal X-linked arthrogryposis multiplex congenita or X-linked arthrogryposis type 1 (AMCX1). Spinal muscular atrophy refers to a group of neuromuscular disorders characterized by degeneration of the anterior horn cells of the spinal cord, leading to symmetrical muscle weakness and atrophy. SMAX2 is a lethal infantile form presenting with hypotonia, areflexia, and multiple congenital contractures.

    Références
  • Jin J, et al. (2007) Dual E1 activation systems for ubiquitin differentially regulate E2 enzyme charging. Nature. 447(7148):1135-8.
  • Xia T, et al. (2007) Chaperone-dependent E3 ligase CHIP ubiquitinates and mediates proteasomal degradation of soluble guanylyl cyclase. Am J Physiol Heart Circ Physiol. 293(5):H3080-7.
  • Pridgeon JW, et al. (2009) Proteomic analysis reveals Hrs UIM-mediated ubiquitin signaling in multiple cellular processes. FEBS J. 276(1):118-31.
  • Size / Price
    Catalogue : CG90821-CH
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité
    Ajouter au panierBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »