After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Macaque de Buffon UBE1 / UBA1 expression plasmide de Gène l'ADNc ORF clone, N-Myc Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Cynomolgus UBA1 Informations sur les produits clonés de cDNA
Taille du ADNc:3177bp
Description du ADNc:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) ubiquitin-like modifier activating enzyme 1 with N terminal Myc tag.
Synonyme du gène:UBA1
Site de restriction:
Séquence du marqueur:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Description de la séquence:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Macaque de Buffon UBE1 / UBA1 expression plasmide de Gène l'ADNc ORF clone, N-Myc Marqueur on other vectors
Macaque de Buffon UBE1 / UBA1 expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurCG90821-ACGCHF390
Macaque de Buffon UBE1 / UBA1 expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurCG90821-ACRCHF390
Macaque de Buffon UBE1 / UBA1 expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurCG90821-ANGCHF390
Macaque de Buffon UBE1 / UBA1 expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurCG90821-ANRCHF390
Macaque de Buffon UBE1 / UBA1 expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurCG90821-CFCHF350
Macaque de Buffon UBE1 / UBA1 expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurCG90821-CHCHF350
Macaque de Buffon UBE1 / UBA1 expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurCG90821-CMCHF350
Macaque de Buffon UBE1 / UBA1 expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurCG90821-CYCHF350
Macaque de Buffon UBE1 / UBA1 Gène ADNc clone le vecteur de clonageCG90821-GCHF90
Macaque de Buffon UBE1 / UBA1 expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurCG90821-NFCHF350
Macaque de Buffon UBE1 / UBA1 expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurCG90821-NHCHF350
Macaque de Buffon UBE1 / UBA1 expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurCG90821-NMCHF350
Macaque de Buffon UBE1 / UBA1 expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurCG90821-NYCHF350
Macaque de Buffon UBE1 / UBA1 expression plasmide de Gène l'ADNc ORF cloneCG90821-UTCHF350
 En savoir plus sur les vecteurs d'expression
Product nameProduct name

UBE1, also known as UBA1, belongs to the ubiquitin-activating E1 family. UBE1 gene complements an X-linked mouse temperature-sensitive defect in DNA synthesis, and thus may function in DNA repair. It is part of a gene cluster on chromosome Xp11.23. UBE1 catalyzes the first step in ubiquitin conjugation to mark cellular proteins for degradation. It also catalyzes the first step in ubiquitin conjugation to mark cellular proteins for degradation by first adenylating its C-terminal glycine residue with ATP, and thereafter linking this residue to the side chain of a cysteine residue in E1, yielding an ubiquitin-E1 thioester and free AMP. Defects in UBA1 can cause spinal muscular atrophy X-linked type 2 (SMAX2), also known as X-linked lethal infantile spinal muscular atrophy, distal X-linked arthrogryposis multiplex congenita or X-linked arthrogryposis type 1 (AMCX1). Spinal muscular atrophy refers to a group of neuromuscular disorders characterized by degeneration of the anterior horn cells of the spinal cord, leading to symmetrical muscle weakness and atrophy. SMAX2 is a lethal infantile form presenting with hypotonia, areflexia, and multiple congenital contractures.

  • Jin J, et al. (2007) Dual E1 activation systems for ubiquitin differentially regulate E2 enzyme charging. Nature. 447(7148):1135-8.
  • Xia T, et al. (2007) Chaperone-dependent E3 ligase CHIP ubiquitinates and mediates proteasomal degradation of soluble guanylyl cyclase. Am J Physiol Heart Circ Physiol. 293(5):H3080-7.
  • Pridgeon JW, et al. (2009) Proteomic analysis reveals Hrs UIM-mediated ubiquitin signaling in multiple cellular processes. FEBS J. 276(1):118-31.
  • Size / Price
    Catalogue : CG90821-NM
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.