WDPCP cDNA ORF Clone, Cynomolgus, N-His tag

Price:
Size:
Number:

WDPCP cDNA ORF Clone, Cynomolgus, N-His tag: General Information

Gene
Species
Cynomolgus
NCBI Ref Seq
RefSeq ORF Size
2127 bp
Description
Full length Clone DNA of Cynomolgus WD repeat containing planar cell polarity effector with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

WDPCP Background Information

Full Name
WD repeat containing planar cell polarity effector

WDPCP cDNA ORF Clone, Human, Related Products

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait