Commande rapide

Text Size:AAA

Dengue virus MINISTÈRE DE L'ENVIRONNEMENT-2 (strain New Guinea C) NS2A ORF mammalian expression plasmid, C-HA Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
DENV DENV-NS2A Informations sur les produits clonés de cDNA
Taille du ADNc:654bp
Description du ADNc:Full length Clone DNA of DENV-2 (strain New Guinea C) NS2A with C terminal HA tag.
Synonyme du gène:DENV-NS2A
Site de restriction:
Séquence du marqueur:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Description de la séquence:Identical with the Gene Bank Ref. ID sequence AF038403.1 (3478..4131), corresponding to amino acid sequence AAC59275.1 (aa 1128-1345).
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at ambient temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Dengue virus MINISTÈRE DE L'ENVIRONNEMENT-2 (strain New Guinea C) NS2A ORF mammalian expression plasmid, C-HA Marqueur on other vectors
Dengue virus MINISTÈRE DE L'ENVIRONNEMENT-2 (strain New Guinea C) NS2A ORF mammalian expression plasmid, C-GFPSpark MarqueurVG40264-ACGCHF390
Dengue virus MINISTÈRE DE L'ENVIRONNEMENT-2 (strain New Guinea C) NS2A ORF mammalian expression plasmid, C-OFPSpark / RFP MarqueurVG40264-ACRCHF390
Dengue virus MINISTÈRE DE L'ENVIRONNEMENT-2 (strain New Guinea C) NS2A ORF mammalian expression plasmid, N-GFPSpark MarqueurVG40264-ANGCHF390
Dengue virus MINISTÈRE DE L'ENVIRONNEMENT-2 (strain New Guinea C) NS2A ORF mammalian expression plasmid, N-OFPSpark / RFP MarqueurVG40264-ANRCHF390
Dengue virus MINISTÈRE DE L'ENVIRONNEMENT-2 (strain New Guinea C) NS2A ORF mammalian expression plasmid, C-Flag MarqueurVG40264-CFCHF350
Dengue virus MINISTÈRE DE L'ENVIRONNEMENT-2 (strain New Guinea C) NS2A ORF mammalian expression plasmid, C-His MarqueurVG40264-CHCHF350
Dengue virus MINISTÈRE DE L'ENVIRONNEMENT-2 (strain New Guinea C) NS2A ORF mammalian expression plasmid, C-Myc MarqueurVG40264-CMCHF350
Dengue virus MINISTÈRE DE L'ENVIRONNEMENT-2 (strain New Guinea C) NS2A ORF mammalian expression plasmid, C-HA MarqueurVG40264-CYCHF350
Dengue virus MINISTÈRE DE L'ENVIRONNEMENT-2 (strain New Guinea C) NS2A ORF mammalian expression plasmid (Codon Optimized)VG40264-GCHF110
Dengue virus MINISTÈRE DE L'ENVIRONNEMENT-2 (strain New Guinea C) NS2A ORF mammalian expression plasmid, N-Flag MarqueurVG40264-NFCHF350
Dengue virus MINISTÈRE DE L'ENVIRONNEMENT-2 (strain New Guinea C) NS2A ORF mammalian expression plasmid, N-His MarqueurVG40264-NHCHF350
Dengue virus MINISTÈRE DE L'ENVIRONNEMENT-2 (strain New Guinea C) NS2A ORF mammalian expression plasmid, N-Myc MarqueurVG40264-NMCHF350
Dengue virus MINISTÈRE DE L'ENVIRONNEMENT-2 (strain New Guinea C) NS2A ORF mammalian expression plasmid, N-HA MarqueurVG40264-NYCHF350
Dengue virus MINISTÈRE DE L'ENVIRONNEMENT-2 (strain New Guinea C) NS2A natural ORF mammalian expression plasmidVG40264-UTCHF350
 En savoir plus sur les vecteurs d'expression
Product nameProduct name
Size / Price
Catalogue : VG40264-CY
Prix catalogue : 
Prix :      (You Save: )
Taille :
Quantité :+-
Disponibilité2-3 weeks
Bulk Discount RequiryAjouter au panier
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.