After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

E. coli Enoyl-ACP Reductase/FABI expression plasmide de Gène l'ADNc ORF clone, C-HA Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
E. coli FABI Informations sur les produits clonés de cDNA
Gene_bank_ref_id:
Taille du ADNc:789bp
Description du ADNc:Full length Clone DNA of Escherichia coli enoyl-[acyl-carrier-protein] reductase, NADH-dependent with C terminal HA tag.
Synonyme du gène:envM
Espèces:E. coli
Vecteur:pCMV3-C-HA
Plasmid:
Site de restriction:
Séquence du marqueur:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Description de la séquence:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

E. coli Enoyl-ACP Reductase/FABI expression plasmide de Gène l'ADNc ORF clone, C-HA Marqueur on other vectors
E. coli Enoyl-ACP Reductase/FABI expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurEG30001-ACGCHF270
E. coli Enoyl-ACP Reductase/FABI expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurEG30001-ACRCHF270
E. coli Enoyl-ACP Reductase/FABI expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurEG30001-ANGCHF270
E. coli Enoyl-ACP Reductase/FABI expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurEG30001-ANRCHF270
E. coli Enoyl-ACP Reductase/FABI expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurEG30001-CFCHF230
E. coli Enoyl-ACP Reductase/FABI expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurEG30001-CHCHF230
E. coli Enoyl-ACP Reductase/FABI expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurEG30001-CMCHF230
E. coli Enoyl-ACP Reductase/FABI expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurEG30001-CYCHF230
E. coli Enoyl-ACP Reductase/FABI Gène ADNc clone le vecteur de clonageEG30001-MCHF90
E. coli Enoyl-ACP Reductase/FABI expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurEG30001-NFCHF230
E. coli Enoyl-ACP Reductase/FABI expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurEG30001-NHCHF230
E. coli Enoyl-ACP Reductase/FABI expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurEG30001-NMCHF230
E. coli Enoyl-ACP Reductase/FABI expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurEG30001-NYCHF230
E. coli Enoyl-ACP Reductase/FABI expression plasmide de Gène l'ADNc ORF cloneEG30001-UTCHF230
 En savoir plus sur les vecteurs d'expression
Product nameProduct name
Fond

Enoyl-ACP reductase, also known as NADH-dependent enoyl-ACP reductase and FABI, is a cell inner membrane and peripheral membrane protein which belongs to the short-chain dehydrogenases/reductases (SDR) family and FabI subfamily. Microorganisms produce many kinds of antibiotics which function in an antagonistic capacity in nature where they have much competition. Bacterial FAS provides essential fatty acids for use in the assembly of key cellular components. Among them, FABI is an enoyl-ACP reductase which catalyzes the final and rate-limiting step of bacterial FAS. The antibiotic diazaborine interferes with the activity by binding to the protein. FABI is a potential target for selective antibacterial action, because it shows low overall sequence homology with mammalian enzymes. Various compounds have been reported as inhibitors of bacterial FabI-inhibitory compounds.

Références
  • Miller, WH. et al., 2002, J Med Chem  45 (15):3246-56. 
  • Kitagawa, H. et al., 2007, Bioorg Med Chem  15 (2):1106-16.
  • Zheng, C.J. et al., 2007, Biochem Biophys Res Commun 362 (4):1107-12.
  • Lu,H. et al., 2008, Acc Chem Res 41 (1):11-20.
  • Zheng,CJ. et al., 2009, J Antimicrob Chemother 63 (5):949-53.
  • Size / Price
    Catalogue : EG30001-CY
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »