Commande rapide

Text Size:AAA

Fiche techniqueCommentairesProduits apparentésProtocoles
Human ELF4 Informations sur les produits clonés de cDNA
Taille du ADNc:
Description du ADNc:
Synonyme du gène:
Site de restriction:
Séquence du marqueur:
Description de la séquence:
Human ELF4 Gene Plasmid Map
Human ELF4 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.