Commande rapide

Furet CD20/MS4A1 expression plasmide de Gène l'ADNc ORF clone, N-HA Marqueur

    Fiche techniqueCommentairesProduits apparentésProtocoles
    Furet MS4A1 Informations sur les produits clonés de cDNA
    Gene_bank_ref_id:
    Taille du ADNc:894bp
    Description du ADNc:Full length Clone DNA of Ferret membrane-spanning 4-domains, subfamily A, member 1 with N terminal HA tag.
    Synonyme du gène:MS4A1
    Espèces:Ferret
    Vecteur:pCMV3-SP-N-HA
    Plasmid:
    Site de restriction:
    Séquence du marqueur:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    Description de la séquence:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Stockage:The lyophilized plasmid can be stored at room temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    Product nameProduct name
    Fond

    CD20 (membrane-spanning 4-domains, subfamily A, member 1), also known as MS4A1, is a member of the membrane-spanning 4A gene family. Members of this nascent protein family are characterized by common structural features and similar intron/exon splice boundaries and display unique expression patterns among hematopoietic cells and nonlymphoid tissues. CD20 / MS4A1 is expressed on all stages of B cell development except the first and last. CD20 / MS4A1 is present from pre-pre B cells through memory cells, but not on either pro-B cells or plasma cells. It is a B-lymphocyte surface molecule which plays a role in the development and differentiation of B-cells into plasma cells. CD20 / MS4A1may be involved in the regulation of B-cell activation and proliferation. Defects in CD20 / MS4A1 are the cause of immunodeficiency common variable type 5(CVID5). CVID5 is a primary immunodeficiency characterized by antibody deficiency, hypogammaglobulinemia, recurrent bacterial infections and an inability to mount an antibody response to antigen. The defect results from a failure of B-cell differentiation and impaired secretion of immunoglobulins; the numbers of circulating B-cells is usually in the normal range, but can be low.

    Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

    Références
  • Tedder TF, et al. (1988) Isolation and structure of a cDNA encoding the B1 (CD20) cell-surface antigen of human B lymphocytes. Proc Natl Acad Sci. 85(1): 208-12.
  • Cragg MS, et al. (2005) The biology of CD20 and its potential as a target for mAb therapy. Curr Dir Autoimmun. 8: 140-74..
  • Polyak MJ, et al. (2003) A cholesterol-dependent CD20 epitope detected by the FMC7 antibody. Leukemia. 17(7): 1384-9.
  • Size / Price
    Catalogue : FG60004-NY
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité
    Ajouter au panierBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
      Articles consultés récemment
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »