After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Furet CD4 expression plasmide de Gène l'ADNc ORF clone, N-HA Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Ferret CD4 Informations sur les produits clonés de cDNA
Gene_bank_ref_id:EF492055.1
Taille du ADNc:1389bp
Description du ADNc:Full length Clone DNA of Ferret CD4 antigen with N terminal HA tag.
Synonyme du gène:CD4
Espèces:Ferret
Vecteur:pCMV3-SP-N-HA
Plasmid:pCMV3-HA-ferCD4
Site de restriction:KpnI + XbaI (6kb + 1.4kb)
Séquence du marqueur:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Description de la séquence:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Ferret CD4 Gene Plasmid Map
Ferret CD4 natural ORF mammalian expression plasmid, N-HA tag
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Fond

T-cell surface glycoprotein CD4,  is a single-pass type I membrane protein. CD4 contains three Ig-like C2-type (immunoglobulin-like) domains and one Ig-like V-type (immunoglobulin-like) domain. CD4 is a glycoprotein expressed on the surface of T helper cells, regulatory T cells, monocytes, macrophages, and dendritic cells. The CD4 surface determinant, previously associated as a phenotypic marker for helper/inducer subsets of T lymphocytes, has now been critically identified as the binding/entry protein for human immunodeficiency viruses (HIV). The human CD4 molecule is readily detectable on monocytes, T lymphocytes, and brain tissues. All human tissue sources of CD4 bind radiolabeled gp120 to the same relative degree; however, the murine homologous protein, L3T4, does not bind the HIV envelope protein. CD4 is a co-receptor that assists the T cell receptor (TCR) to activate its T cell following an interaction with an antigen presenting cell. Using its portion that resides inside the T cell, CD4 amplifies the signal generated by the TCR. CD4 interacts directly with MHC class II molecules on the surface of the antigen presenting cell via its extracellular domain. The CD4 molecule is currently the object of intense interest and investigation both because of its role in normal T-cell function, and because of its role in HIV infection. CD4 is a primary receptor used by HIV-1 to gain entry into host T cells. HIV infection leads to a progressive reduction of the number of T cells possessing CD4 receptors.

Viral protein U (VpU) of HIV-1 plays an important role in downregulation of the main HIV-1 receptor CD4 from the surface of infected cells. Physical binding of VpU to newly synthesized CD4 in the endoplasmic reticulum is an early step in a pathway leading to proteasomal degradation of CD4. Amino acids in both helices found in the cytoplasmic region of VpU in membrane-mimicking detergent micelles experience chemical shift perturbations upon binding to CD4, whereas amino acids between the two helices and at the C-terminus of VpU show no or only small changes, respectively. Paramagnetic spin labels were attached at three sequence positions of a CD4 peptide comprising the transmembrane and cytosolic domains of the receptor. VpU binds to a membrane-proximal region in the cytoplasmic domain of CD4.

Références
  • Farrar WL, et al. (1988) Characterization of CD4 glycoprotein determinant-HIV envelope protein interactions: perspectives for analog and vaccine development. Crit Rev Immunol. 8(4): 315-39.
  • Biddison WE, et al. (1989) CD4 expression and function in HLA class II-specific T cells. Immunol Rev. 109: 5-15.
  • Singh SK, et al. (2012) Mapping the interaction between the cytoplasmic domains of HIV-1 viral protein U and human CD4 with NMR spectroscopy. FEBS J. 279(19):3705-14.
  • Size / Price
    Catalogue : FG60003-NY
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    DisponibilitéIn Stock
    Bulk Discount RequiryAjouter au panier
    Contact Us
    Images
    • Ferret CD4 natural ORF mammalian expression plasmid, N-HA tag
      Articles consultés récemment
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »