HEBP1 cDNA ORF Clone, Ferret, C-Myc tag

Cat: FG60060-CM

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All HEBP1 Reagents

CRO Services

Product recommended


All HEBP1 Reagents

HEBP1 cDNA ORF Clone, Ferret, C-Myc tag General Information

Gene

Species
Ferret
NCBI Ref Seq
RefSeq ORF Size
570 bp
Description
Full length Clone DNA of Ferret heme binding protein 1 with C terminal Myc tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

HEBP1 Background Information

Full Name
heme binding protein 1

HEBP1 cDNA ORF Clone, Ferret, Related Products

Product Name Catalog#(PDF)
HEBP1 cDNA ORF Clone in Cloning Vector, Ferret FG60060-G
HEBP1 cDNA ORF Clone, Ferret, untagged FG60060-UT
HEBP1 cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60060-ACG
HEBP1 Lentiviral cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60060-ACGLN
HEBP1 cDNA ORF Clone, Ferret, N-GFPSpark® tag FG60060-ANG
HEBP1 cDNA ORF Clone, Ferret, C-OFPSpark® tag FG60060-ACR
HEBP1 cDNA ORF Clone, Ferret, N-OFPSpark® tag FG60060-ANR
HEBP1 cDNA ORF Clone, Ferret, C-DDK (Flag®) tag FG60060-CF
HEBP1 cDNA ORF Clone, Ferret, N-DDK (Flag®) tag FG60060-NF
HEBP1 cDNA ORF Clone, Ferret, C-His tag FG60060-CH
HEBP1 cDNA ORF Clone, Ferret, N-His tag FG60060-NH
HEBP1 cDNA ORF Clone, Ferret, C-HA tag FG60060-CY
HEBP1 cDNA ORF Clone, Ferret, N-HA tag FG60060-NY
HEBP1 cDNA ORF Clone, Ferret, N-Myc tag FG60060-NM

HEBP1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
HEBP1 cDNA ORF Clone in Cloning Vector, Mouse MG53845-U
HEBP1 cDNA ORF Clone, Mouse, untagged MG53845-UT
HEBP1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53845-ACGLN
HEBP1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53845-ACG
HEBP1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53845-ANG
HEBP1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53845-ACR
HEBP1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53845-ANR
HEBP1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53845-CF
HEBP1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53845-NF
HEBP1 cDNA ORF Clone, Mouse, C-His tag MG53845-CH
HEBP1 cDNA ORF Clone, Mouse, N-His tag MG53845-NH
HEBP1 cDNA ORF Clone, Mouse, C-HA tag MG53845-CY
HEBP1 cDNA ORF Clone, Mouse, N-HA tag MG53845-NY
HEBP1 cDNA ORF Clone, Mouse, C-Myc tag MG53845-CM
HEBP1 cDNA ORF Clone, Mouse, N-Myc tag MG53845-NM

HEBP1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
HEBP1 cDNA ORF Clone, Human, untagged HG22089-UT
info info
添加购物车成功! 添加购物车失败!