After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Commande rapide

Text Size:AAA

Furet Interferon Gamma/IFN gamma/IFNG expression plasmide de Gène l'ADNc ORF clone, N-HA Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Ferret IFNG Informations sur les produits clonés de cDNA
Gene_bank_ref_id:AB300566.1
Taille du ADNc:501bp
Description du ADNc:Full length Clone DNA of Ferret Interferon gamma with N terminal HA tag.
Synonyme du gène:IFNG
Espèces:Ferret
Vecteur:pCMV3-SP-N-HA
Plasmid:
Site de restriction:
Séquence du marqueur:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Description de la séquence:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Furet Interferon Gamma/IFN gamma/IFNG expression plasmide de Gène l'ADNc ORF clone, N-HA Marqueur on other vectors
Furet Interferon Gamma/IFN gamma/IFNG expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurFG60007-ACGCHF270
Furet Interferon Gamma/IFN gamma/IFNG expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurFG60007-ACRCHF270
Furet Interferon Gamma/IFN gamma/IFNG expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurFG60007-CFCHF234
Furet Interferon Gamma/IFN gamma/IFNG expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurFG60007-CHCHF234
Furet Interferon Gamma/IFN gamma/IFNG expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurFG60007-CMCHF234
Furet Interferon Gamma/IFN gamma/IFNG expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurFG60007-CYCHF234
Furet Interferon Gamma/IFN gamma/IFNG Gène ADNc clone le vecteur de clonageFG60007-GCHF90
Furet Interferon Gamma/IFN gamma/IFNG expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurFG60007-G-HCHF234
Furet Interferon Gamma/IFN gamma/IFNG expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurFG60007-NFCHF234
Furet Interferon Gamma/IFN gamma/IFNG expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurFG60007-NHCHF234
Furet Interferon Gamma/IFN gamma/IFNG expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurFG60007-NMCHF234
Furet Interferon Gamma/IFN gamma/IFNG expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurFG60007-NYCHF234
Furet Interferon Gamma/IFN gamma/IFNG expression plasmide de Gène l'ADNc ORF cloneFG60007-UTCHF234
 En savoir plus sur les vecteurs d'expression
Product nameProduct name
Fond

IFN gamma, also known as IFNG, is a secreted protein which belongs to the type I I interferon family. IFN gamma is produced predominantly by natural killer and natural killer T cells as part of the innate immune response, and by CD4 and CD8 cytotoxic T lymphocyte effector T cells once antigen-specific immunity develops. IFN gamma has antiviral, immunoregulatory, and anti-tumor properties. IFNG, in addition to having antiviral activity, has important immunoregulatory functions, it is a potent activator of macrophages, and has antiproliferative effects on transformed cells and it can potentiate the antiviral and antitumor effects of the type I interferons. The IFNG monomer consists of a core of six α-helices and an extended unfolded sequence in the C-terminal region. IFN gamma is critical for innate and adaptive immunity against viral and intracellular bacterial infections and for tumor control. Aberrant IFN gamma expression is associated with a number of autoinflammatory and autoimmune diseases. The importance of IFN gamma in the immune system stems in part from its ability to inhibit viral replication directly, and most importantly from its immunostimulatory and immunomodulatory effects. IFNG also promotes NK cell activity.

Références
  • Gray P W, et al. (1982) Structure of the human immune interferon gene. Nature. 298: 859-63.
  • Taya Y, et al. (1982) Cloning and structure of the human immune interferon-gamma chromosomal gene. EMBO J. 1: 953-8.
  • Goshima N, et al. (2008) Human protein factory for converting the transcriptome into an in vitro-expressed proteome. Nomura N Nat Methods. 5: 1011-7.
  • Thiel DJ, et al. (2000) Observation of an unexpected third receptor molecule in the crystal structure of human interferon-gamma receptor complex. Structure. 8 (9): 927-36.
  • Naylor SL, et al. (1983) Human immune interferon gene is located on chromosome 12. J Exp Med. 157 (3): 1020-7.
  • Schoenborn JR, et al. (2007) Regulation of interferon-gamma during innate and adaptive immune responses. Adv Immunol. 96: 41-101.
  • Size / Price
    Catalogue : FG60007-NY
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »