Commande rapide

Furet METTL3/Methyltransferase like 3 expression plasmide de Gène l'ADNc ORF clone, C-HA Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Ferret METTL3 Informations sur les produits clonés de cDNA
Taille du ADNc:1743bp
Description du ADNc:Full length Clone DNA of Mustela putorius furo (sub-species: furo) methyltransferase like 3 with C terminal HA tag.
Synonyme du gène:METTL3
Site de restriction:
Séquence du marqueur:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Description de la séquence:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Furet METTL3/Methyltransferase like 3 expression plasmide de Gène l'ADNc ORF clone, C-HA Marqueur on other vectors
Furet METTL3/Methyltransferase like 3 expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurFG60040-ACGCHF290
Furet METTL3/Methyltransferase like 3 expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurFG60040-ACRCHF290
Furet METTL3/Methyltransferase like 3 expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurFG60040-ANGCHF290
Furet METTL3/Methyltransferase like 3 expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurFG60040-ANRCHF290
Furet METTL3/Methyltransferase like 3 expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurFG60040-CFCHF260
Furet METTL3/Methyltransferase like 3 expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurFG60040-CHCHF260
Furet METTL3/Methyltransferase like 3 expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurFG60040-CMCHF260
Furet METTL3/Methyltransferase like 3 expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurFG60040-CYCHF260
Furet METTL3/Methyltransferase like 3 Gène ADNc clone le vecteur de clonageFG60040-GCHF90
Furet METTL3/Methyltransferase like 3 expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurFG60040-NFCHF260
Furet METTL3/Methyltransferase like 3 expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurFG60040-NHCHF260
Furet METTL3/Methyltransferase like 3 expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurFG60040-NMCHF260
Furet METTL3/Methyltransferase like 3 expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurFG60040-NYCHF260
Furet METTL3/Methyltransferase like 3 expression plasmide de Gène l'ADNc ORF cloneFG60040-UTCHF260
 En savoir plus sur les vecteurs d'expression
Product nameProduct name
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.