After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Commande rapide

Text Size:AAA

Furet TNF-alpha/TNFA/TNFSF2 expression plasmide de Gène l'ADNc ORF clone, N-HA Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Ferret TNF Informations sur les produits clonés de cDNA
Gene_bank_ref_id:EF368211.1
Taille du ADNc:702bp
Description du ADNc:Full length Clone DNA of Ferret TNF alpha with N terminal HA tag.
Synonyme du gène:TNFA
Espèces:Ferret
Vecteur:pCMV3-SP-N-HA
Plasmid:
Site de restriction:
Séquence du marqueur:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Description de la séquence:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Fond

Tumor necrosis factor alpha (TNF-alpha), also known as TNF, TNFA or TNFSF2, is the prototypic cytokine of the TNF superfamily, and is a multifunctional molecule involved in the regulation of a wide spectrum of biological processes including cell proliferation, differentiation, apoptosis, lipid metabolism, and coagulation. Two receptors, TNF-R1 (TNF receptor type 1; CD120a; p55/60) and TNF-R2 (TNF receptor type 2; CD120b; p75/80), bind to TNF-alpha. TNF-alpha protein is produced mainly by macrophages, and large amounts of this cytokine are released in response to lipopolysaccharide, other bacterial products, and Interleukin-1 (IL-1). TNF-alpha is involved in fighting against the tumorigenesis, thus, is regarded as a molecular insight in cancer treatment.

TNF-alpha Protein & Antibody

Références
  • Hector J, et al. (2007) TNF-alpha alters visfatin and adiponectin levels in human fat. Horm Metab Res. 39(4): 250-5.
  • Berthold-Losleben M, et al. (2008) The TNF-alpha System: Functional Aspects in Depression, Narcolepsy and Psychopharmacology. Curr Neuropharmacol. 6(3): 193-202.
  • Size / Price
    Catalogue : FG60002-NY
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »