After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Commande rapide

Text Size:AAA

Humain HHIP expression plasmide de Gène l'ADNc ORF clone, C-His Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Human HHIP Informations sur les produits clonés de cDNA
Gene_bank_ref_id:NM_022475.2
Taille du ADNc:2103bp
Description du ADNc:Full length Clone DNA of Homo sapiens hedgehog interacting protein with His tag.
Synonyme du gène:HIP, HHIP
Espèces:Human
Vecteur:pCMV/hygro-His
Plasmid:pCMV-HHIP-10his
Site de restriction:KpnI + XhoI (5.5kb + 2.13kb)
Séquence du marqueur:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Description de la séquence:Identical with the Gene Bank Ref.ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Human HHIP Gene Plasmid Map
Human HHIP Gene cDNA Clone (full-length ORF Clone), expression ready, His-tagged
pCMV/hygro-HIs Vector Information
 
Vector Name pCMV/hygro-His
Vector Size 5687bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

Schematic of pCMV/hygro-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Size / Price
Catalogue : HG13798-G-H
Prix catalogue : 
Prix :      (You Save: )
Taille :
Quantité :+-
DisponibilitéIn Stock
Bulk Discount RequiryAjouter au panier
Contact Us
Images
  • Human HHIP Gene cDNA Clone (full-length ORF Clone), expression ready, His-tagged
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »