After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Commande rapide

Text Size:AAA

Humain ITGB1 / Integrin beta-1 / CD29 transcript variant 1A expression plasmide de Gène l'ADNc ORF clone, C-Myc Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Human ITGB1 Informations sur les produits clonés de cDNA
Gene_bank_ref_id:NM_002211.3
Taille du ADNc:2397bp
Description du ADNc:Full length Clone DNA of Homo sapiens integrin, beta 1 (fibronectin receptor, beta polypeptide, antigen CD29 includes MDF2, MSK12), transcript variant 1A with C terminal Myc tag.
Synonyme du gène:CD29, FNRB, MDF2, VLAB, GPIIA, MSK12, VLA-BETA
Espèces:Human
Vecteur:pCMV3-C-Myc
Plasmid:pCMV3-ITGB1-Myc
Site de restriction:KpnI + XbaI (6kb + 2.44kb)
Séquence du marqueur:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Description de la séquence:Identical with the Gene Bank Ref. ID sequence except for the point mutations: 459T/C not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Human ITGB1 Gene Plasmid Map
HHuman Integrin beta1 transcript variant 1A ORF mammalian expression plasmid, C-Myc tag
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Humain ITGB1 / Integrin beta-1 / CD29 transcript variant 1A expression plasmide de Gène l'ADNc ORF clone, C-Myc Marqueur on other vectors
Humain ITGB1 / Integrin beta-1 / CD29 transcript variant 1A expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurHG10587-ACGCHF290
Humain ITGB1 / Integrin beta-1 / CD29 transcript variant 1A expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurHG10587-ACRCHF290
Humain ITGB1 / Integrin beta-1 / CD29 transcript variant 1A expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurHG10587-ANGCHF290
Humain ITGB1 / Integrin beta-1 / CD29 transcript variant 1A expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurHG10587-ANRCHF290
Humain ITGB1 / Integrin beta-1 / CD29 transcript variant 1A expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG10587-CFCHF260
Humain ITGB1 / Integrin beta-1 / CD29 transcript variant 1A expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurHG10587-CHCHF260
Humain ITGB1 / Integrin beta-1 / CD29 transcript variant 1A expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurHG10587-CMCHF260
Humain ITGB1 / Integrin beta-1 / CD29 transcript variant 1A expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurHG10587-CYCHF260
Humain ITGB1 / Integrin beta-1 / CD29 transcript variant 1A Gène ADNc clone le vecteur de clonageHG10587-MCHF90
Humain ITGB1 / Integrin beta-1 / CD29 transcript variant 1A expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurHG10587-NFCHF260
Humain ITGB1 / Integrin beta-1 / CD29 transcript variant 1A expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurHG10587-NHCHF260
Humain ITGB1 / Integrin beta-1 / CD29 transcript variant 1A expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurHG10587-NMCHF260
Humain ITGB1 / Integrin beta-1 / CD29 transcript variant 1A expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurHG10587-NYCHF260
Humain ITGB1 / Integrin beta-1 / CD29 transcript variant 1A expression plasmide de Gène l'ADNc ORF cloneHG10587-UTCHF260
 En savoir plus sur les vecteurs d'expression
Product nameProduct name
Size / Price
Catalogue : HG10587-CM
Prix catalogue : 
Prix :      (You Save: )
Taille :
Quantité :+-
DisponibilitéIn Stock
Bulk Discount RequiryAjouter au panier
Contact Us
Images
  • HHuman Integrin beta1 transcript variant 1A ORF mammalian expression plasmid, C-Myc tag
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »