Commande rapide

Text Size:AAA

HIV-1 (group M, subtype B, strain HXB2) gag ORF mammalian expression plasmid, N-His Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
HIV HIV-gag Informations sur les produits clonés de cDNA
Taille du ADNc:1503bp
Description du ADNc:Full length Clone DNA of HIV-1 (group M, subtype B, strain HXB2) gag with N terminal His tag.
Synonyme du gène:HIV-gag
Site de restriction:
Séquence du marqueur:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Description de la séquence:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at ambient temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

HIV-1 (group M, subtype B, strain HXB2) gag ORF mammalian expression plasmid, N-His Marqueur on other vectors
HIV-1 (group M, subtype B, strain HXB2) gag ORF mammalian expression plasmid, C-GFPSpark MarqueurVG40243-ACGCHF410
HIV-1 (group M, subtype B, strain HXB2) gag ORF mammalian expression plasmid, C-OFPSpark / RFP MarqueurVG40243-ACRCHF410
HIV-1 (group M, subtype B, strain HXB2) gag ORF mammalian expression plasmid, N-GFPSpark MarqueurVG40243-ANGCHF410
HIV-1 (group M, subtype B, strain HXB2) gag ORF mammalian expression plasmid, N-OFPSpark / RFP MarqueurVG40243-ANRCHF410
HIV-1 (group M, subtype B, strain HXB2) gag ORF mammalian expression plasmid, C-Flag MarqueurVG40243-CFCHF380
HIV-1 (group M, subtype B, strain HXB2) gag ORF mammalian expression plasmid, C-His MarqueurVG40243-CHCHF380
HIV-1 (group M, subtype B, strain HXB2) gag ORF mammalian expression plasmid, C-Myc MarqueurVG40243-CMCHF380
HIV-1 (group M, subtype B, strain HXB2) gag ORF mammalian expression plasmid, C-HA MarqueurVG40243-CYCHF380
HIV-1 (group M, subtype B, strain HXB2) gag ORF mammalian expression plasmid (Codon Optimized)VG40243-GCHF140
HIV-1 (group M, subtype B, strain HXB2) gag ORF mammalian expression plasmid, N-Flag MarqueurVG40243-NFCHF380
HIV-1 (group M, subtype B, strain HXB2) gag ORF mammalian expression plasmid, N-His MarqueurVG40243-NHCHF380
HIV-1 (group M, subtype B, strain HXB2) gag ORF mammalian expression plasmid, N-Myc MarqueurVG40243-NMCHF380
HIV-1 (group M, subtype B, strain HXB2) gag ORF mammalian expression plasmid, N-HA MarqueurVG40243-NYCHF380
HIV-1 (group M, subtype B, strain HXB2) gag natural ORF mammalian expression plasmidVG40243-UTCHF380
 En savoir plus sur les vecteurs d'expression
Product nameProduct name
Size / Price
Catalogue : VG40243-NH
Prix catalogue : 
Prix :      (You Save: )
Taille :
Quantité :+-
Disponibilité2-3 weeks
Bulk Discount RequiryAjouter au panier
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.