After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

HIV-1 (group M, subtype B, strain HXB2) gag ORF mammalian expression plasmid, N-His Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
HIV HIV-gag Informations sur les produits clonés de cDNA
Gene_bank_ref_id:K03455
Taille du ADNc:1503bp
Description du ADNc:Full length Clone DNA of HIV-1 (group M, subtype B, strain HXB2) gag with N terminal His tag.
Synonyme du gène:HIV-gag
Espèces:HIV
Vecteur:pCMV3-N-His
Plasmid:
Site de restriction:
Séquence du marqueur:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Description de la séquence:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at ambient temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

HIV-1 (group M, subtype B, strain HXB2) gag ORF mammalian expression plasmid, N-His Marqueur on other vectors
HIV-1 (group M, subtype B, strain HXB2) gag ORF mammalian expression plasmid, C-GFPSpark MarqueurVG40243-ACGCHF410
HIV-1 (group M, subtype B, strain HXB2) gag ORF mammalian expression plasmid, C-OFPSpark / RFP MarqueurVG40243-ACRCHF410
HIV-1 (group M, subtype B, strain HXB2) gag ORF mammalian expression plasmid, N-GFPSpark MarqueurVG40243-ANGCHF410
HIV-1 (group M, subtype B, strain HXB2) gag ORF mammalian expression plasmid, N-OFPSpark / RFP MarqueurVG40243-ANRCHF410
HIV-1 (group M, subtype B, strain HXB2) gag ORF mammalian expression plasmid, C-Flag MarqueurVG40243-CFCHF380
HIV-1 (group M, subtype B, strain HXB2) gag ORF mammalian expression plasmid, C-His MarqueurVG40243-CHCHF380
HIV-1 (group M, subtype B, strain HXB2) gag ORF mammalian expression plasmid, C-Myc MarqueurVG40243-CMCHF380
HIV-1 (group M, subtype B, strain HXB2) gag ORF mammalian expression plasmid, C-HA MarqueurVG40243-CYCHF380
HIV-1 (group M, subtype B, strain HXB2) gag ORF mammalian expression plasmid (Codon Optimized)VG40243-GCHF140
HIV-1 (group M, subtype B, strain HXB2) gag ORF mammalian expression plasmid, N-Flag MarqueurVG40243-NFCHF380
HIV-1 (group M, subtype B, strain HXB2) gag ORF mammalian expression plasmid, N-His MarqueurVG40243-NHCHF380
HIV-1 (group M, subtype B, strain HXB2) gag ORF mammalian expression plasmid, N-Myc MarqueurVG40243-NMCHF380
HIV-1 (group M, subtype B, strain HXB2) gag ORF mammalian expression plasmid, N-HA MarqueurVG40243-NYCHF380
HIV-1 (group M, subtype B, strain HXB2) gag natural ORF mammalian expression plasmidVG40243-UTCHF380
 En savoir plus sur les vecteurs d'expression
Product nameProduct name
Size / Price
Catalogue : VG40243-NH
Prix catalogue : 
Prix :      (You Save: )
Taille :
Quantité :+-
Disponibilité2-3 weeks
Bulk Discount RequiryAjouter au panier
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »