Commande rapide

Text Size:AAA

HIV-1 (group M, subtype B, strain HXB2) nef ORF mammalian expression plasmid, N-His Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
HIV HIV-nef Informations sur les produits clonés de cDNA
Taille du ADNc:372bp
Description du ADNc:Full length Clone DNA of HIV-1 (group M, subtype B, strain HXB2) nef with N terminal His tag.
Synonyme du gène:HIV-nef
Site de restriction:
Séquence du marqueur:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Description de la séquence:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at ambient temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

HIV-1 (group M, subtype B, strain HXB2) nef ORF mammalian expression plasmid, N-His Marqueur on other vectors
HIV-1 (group M, subtype B, strain HXB2) nef ORF mammalian expression plasmid, C-GFPSpark MarqueurVG40249-ACGCHF390
HIV-1 (group M, subtype B, strain HXB2) nef ORF mammalian expression plasmid, C-OFPSpark / RFP MarqueurVG40249-ACRCHF390
HIV-1 (group M, subtype B, strain HXB2) nef ORF mammalian expression plasmid, N-GFPSpark MarqueurVG40249-ANGCHF390
HIV-1 (group M, subtype B, strain HXB2) nef ORF mammalian expression plasmid, N-OFPSpark / RFP MarqueurVG40249-ANRCHF390
HIV-1 (group M, subtype B, strain HXB2) nef ORF mammalian expression plasmid, C-Flag MarqueurVG40249-CFCHF350
HIV-1 (group M, subtype B, strain HXB2) nef ORF mammalian expression plasmid, C-His MarqueurVG40249-CHCHF350
HIV-1 (group M, subtype B, strain HXB2) nef ORF mammalian expression plasmid, C-Myc MarqueurVG40249-CMCHF350
HIV-1 (group M, subtype B, strain HXB2) nef ORF mammalian expression plasmid, C-HA MarqueurVG40249-CYCHF350
HIV-1 (group M, subtype B, strain HXB2) nef ORF mammalian expression plasmid (Codon Optimized)VG40249-GCHF110
HIV-1 (group M, subtype B, strain HXB2) nef ORF mammalian expression plasmid, N-Flag MarqueurVG40249-NFCHF350
HIV-1 (group M, subtype B, strain HXB2) nef ORF mammalian expression plasmid, N-His MarqueurVG40249-NHCHF350
HIV-1 (group M, subtype B, strain HXB2) nef ORF mammalian expression plasmid, N-Myc MarqueurVG40249-NMCHF350
HIV-1 (group M, subtype B, strain HXB2) nef ORF mammalian expression plasmid, N-HA MarqueurVG40249-NYCHF350
HIV-1 (group M, subtype B, strain HXB2) nef natural ORF mammalian expression plasmidVG40249-UTCHF350
 En savoir plus sur les vecteurs d'expression
Product nameProduct name
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.