Commande rapide

HIV-1 (group M, subtype B, strain HXB2) nef ORF mammalian expression plasmid, N-His Marqueur

    Fiche techniqueCommentairesProduits apparentésProtocoles
    HIV HIV-nef Informations sur les produits clonés de cDNA
    Gene_bank_ref_id:K03455
    Taille du ADNc:372bp
    Description du ADNc:Full length Clone DNA of HIV-1 (group M, subtype B, strain HXB2) nef with N terminal His tag.
    Synonyme du gène:HIV-nef
    Espèces:HIV
    Vecteur:pCMV3-N-His
    Plasmid:
    Site de restriction:
    Séquence du marqueur:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Description de la séquence:Identical with the Gene Bank Ref. ID sequence.
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Stockage:The lyophilized plasmid can be stored at ambient temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    HIV-1 (group M, subtype B, strain HXB2) nef ORF mammalian expression plasmid, N-His Marqueur on other vectors
    HIV-1 (group M, subtype B, strain HXB2) nef ORF mammalian expression plasmid, C-GFPSpark MarqueurVG40249-ACGCHF390
    HIV-1 (group M, subtype B, strain HXB2) nef ORF mammalian expression plasmid, C-OFPSpark / RFP MarqueurVG40249-ACRCHF390
    HIV-1 (group M, subtype B, strain HXB2) nef ORF mammalian expression plasmid, N-GFPSpark MarqueurVG40249-ANGCHF390
    HIV-1 (group M, subtype B, strain HXB2) nef ORF mammalian expression plasmid, N-OFPSpark / RFP MarqueurVG40249-ANRCHF390
    HIV-1 (group M, subtype B, strain HXB2) nef ORF mammalian expression plasmid, C-Flag MarqueurVG40249-CFCHF350
    HIV-1 (group M, subtype B, strain HXB2) nef ORF mammalian expression plasmid, C-His MarqueurVG40249-CHCHF350
    HIV-1 (group M, subtype B, strain HXB2) nef ORF mammalian expression plasmid, C-Myc MarqueurVG40249-CMCHF350
    HIV-1 (group M, subtype B, strain HXB2) nef ORF mammalian expression plasmid, C-HA MarqueurVG40249-CYCHF350
    HIV-1 (group M, subtype B, strain HXB2) nef ORF mammalian expression plasmid (Codon Optimized)VG40249-GCHF110
    HIV-1 (group M, subtype B, strain HXB2) nef ORF mammalian expression plasmid, N-Flag MarqueurVG40249-NFCHF350
    HIV-1 (group M, subtype B, strain HXB2) nef ORF mammalian expression plasmid, N-His MarqueurVG40249-NHCHF350
    HIV-1 (group M, subtype B, strain HXB2) nef ORF mammalian expression plasmid, N-Myc MarqueurVG40249-NMCHF350
    HIV-1 (group M, subtype B, strain HXB2) nef ORF mammalian expression plasmid, N-HA MarqueurVG40249-NYCHF350
    HIV-1 (group M, subtype B, strain HXB2) nef natural ORF mammalian expression plasmidVG40249-UTCHF350
     En savoir plus sur les vecteurs d'expression
    Product nameProduct name
    Size / Price
    Catalogue : VG40249-NH
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité
    Ajouter au panierBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
      Articles consultés récemment
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »