Commande rapide

Text Size:AAA

HIV-1 (group M, subtype B, strain HXB2) rev ORF mammalian expression plasmid, N-His Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
HIV HIV-rev Informations sur les produits clonés de cDNA
Taille du ADNc:351bp
Description du ADNc:Full length Clone DNA of HIV-1 (group M, subtype B, strain HXB2) rev with N terminal His tag.
Synonyme du gène:HIV-rev
Site de restriction:
Séquence du marqueur:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Description de la séquence:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at ambient temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

HIV-1 (group M, subtype B, strain HXB2) rev ORF mammalian expression plasmid, N-His Marqueur on other vectors
HIV-1 (group M, subtype B, strain HXB2) rev ORF mammalian expression plasmid, C-GFPSpark MarqueurVG40247-ACGCHF390
HIV-1 (group M, subtype B, strain HXB2) rev ORF mammalian expression plasmid, C-OFPSpark / RFP MarqueurVG40247-ACRCHF390
HIV-1 (group M, subtype B, strain HXB2) rev ORF mammalian expression plasmid, N-GFPSpark MarqueurVG40247-ANGCHF390
HIV-1 (group M, subtype B, strain HXB2) rev ORF mammalian expression plasmid, N-OFPSpark / RFP MarqueurVG40247-ANRCHF390
HIV-1 (group M, subtype B, strain HXB2) rev ORF mammalian expression plasmid, C-Flag MarqueurVG40247-CFCHF350
HIV-1 (group M, subtype B, strain HXB2) rev ORF mammalian expression plasmid, C-His MarqueurVG40247-CHCHF350
HIV-1 (group M, subtype B, strain HXB2) rev ORF mammalian expression plasmid, C-Myc MarqueurVG40247-CMCHF350
HIV-1 (group M, subtype B, strain HXB2) rev ORF mammalian expression plasmid, C-HA MarqueurVG40247-CYCHF350
HIV-1 (group M, subtype B, strain HXB2) rev ORF mammalian expression plasmid (Codon Optimized)VG40247-GCHF110
HIV-1 (group M, subtype B, strain HXB2) rev ORF mammalian expression plasmid, N-Flag MarqueurVG40247-NFCHF350
HIV-1 (group M, subtype B, strain HXB2) rev ORF mammalian expression plasmid, N-His MarqueurVG40247-NHCHF350
HIV-1 (group M, subtype B, strain HXB2) rev ORF mammalian expression plasmid, N-Myc MarqueurVG40247-NMCHF350
HIV-1 (group M, subtype B, strain HXB2) rev ORF mammalian expression plasmid, N-HA MarqueurVG40247-NYCHF350
HIV-1 (group M, subtype B, strain HXB2) rev natural ORF mammalian expression plasmidVG40247-UTCHF350
 En savoir plus sur les vecteurs d'expression
Product nameProduct name
Size / Price
Catalogue : VG40247-NH
Prix catalogue : 
Prix :      (You Save: )
Taille :
Quantité :+-
Disponibilité2-3 weeks
Bulk Discount RequiryAjouter au panier
Contact Us
      Articles consultés récemment
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.