Commande rapide

HIV-1 (group M, subtype B, strain HXB2) rev ORF mammalian expression plasmid, N-His Marqueur

    Fiche techniqueCommentairesProduits apparentésProtocoles
    HIV HIV-rev Informations sur les produits clonés de cDNA
    Gene_bank_ref_id:K03455
    Taille du ADNc:351bp
    Description du ADNc:Full length Clone DNA of HIV-1 (group M, subtype B, strain HXB2) rev with N terminal His tag.
    Synonyme du gène:HIV-rev
    Espèces:HIV
    Vecteur:pCMV3-N-His
    Plasmid:
    Site de restriction:
    Séquence du marqueur:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Description de la séquence:Identical with the Gene Bank Ref. ID sequence.
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Stockage:The lyophilized plasmid can be stored at ambient temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    HIV-1 (group M, subtype B, strain HXB2) rev ORF mammalian expression plasmid, N-His Marqueur on other vectors
    HIV-1 (group M, subtype B, strain HXB2) rev ORF mammalian expression plasmid, C-GFPSpark MarqueurVG40247-ACGCHF390
    HIV-1 (group M, subtype B, strain HXB2) rev ORF mammalian expression plasmid, C-OFPSpark / RFP MarqueurVG40247-ACRCHF390
    HIV-1 (group M, subtype B, strain HXB2) rev ORF mammalian expression plasmid, N-GFPSpark MarqueurVG40247-ANGCHF390
    HIV-1 (group M, subtype B, strain HXB2) rev ORF mammalian expression plasmid, N-OFPSpark / RFP MarqueurVG40247-ANRCHF390
    HIV-1 (group M, subtype B, strain HXB2) rev ORF mammalian expression plasmid, C-Flag MarqueurVG40247-CFCHF350
    HIV-1 (group M, subtype B, strain HXB2) rev ORF mammalian expression plasmid, C-His MarqueurVG40247-CHCHF350
    HIV-1 (group M, subtype B, strain HXB2) rev ORF mammalian expression plasmid, C-Myc MarqueurVG40247-CMCHF350
    HIV-1 (group M, subtype B, strain HXB2) rev ORF mammalian expression plasmid, C-HA MarqueurVG40247-CYCHF350
    HIV-1 (group M, subtype B, strain HXB2) rev ORF mammalian expression plasmid (Codon Optimized)VG40247-GCHF110
    HIV-1 (group M, subtype B, strain HXB2) rev ORF mammalian expression plasmid, N-Flag MarqueurVG40247-NFCHF350
    HIV-1 (group M, subtype B, strain HXB2) rev ORF mammalian expression plasmid, N-His MarqueurVG40247-NHCHF350
    HIV-1 (group M, subtype B, strain HXB2) rev ORF mammalian expression plasmid, N-Myc MarqueurVG40247-NMCHF350
    HIV-1 (group M, subtype B, strain HXB2) rev ORF mammalian expression plasmid, N-HA MarqueurVG40247-NYCHF350
    HIV-1 (group M, subtype B, strain HXB2) rev natural ORF mammalian expression plasmidVG40247-UTCHF350
     En savoir plus sur les vecteurs d'expression
    Product nameProduct name
    Size / Price
    Catalogue : VG40247-NH
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité
    Ajouter au panierBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »