Commande rapide

HIV-1 (group N, strain 06CM-U14296) gag ORF mammalian expression plasmid, C-HA Marqueur

    Fiche techniqueCommentairesProduits apparentésProtocoles
    HIV HIV-gag Informations sur les produits clonés de cDNA
    Taille du ADNc:1536bp
    Description du ADNc:Full length Clone DNA of HIV-1 (group N, strain 06CM-U14296) gag with C terminal HA tag.
    Synonyme du gène:HIV-gag
    Site de restriction:
    Séquence du marqueur:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    Description de la séquence:Identical with the Gene Bank Ref. ID sequence.
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Stockage:The lyophilized plasmid can be stored at ambient temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    HIV-1 (group N, strain 06CM-U14296) gag ORF mammalian expression plasmid, C-HA Marqueur on other vectors
    HIV-1 (group N, strain 06CM-U14296) gag ORF mammalian expression plasmid, C-GFPSpark MarqueurVG40254-ACGCHF410
    HIV-1 (group N, strain 06CM-U14296) gag ORF mammalian expression plasmid, C-OFPSpark / RFP MarqueurVG40254-ACRCHF410
    HIV-1 (group N, strain 06CM-U14296) gag ORF mammalian expression plasmid, N-GFPSpark MarqueurVG40254-ANGCHF410
    HIV-1 (group N, strain 06CM-U14296) gag ORF mammalian expression plasmid, N-OFPSpark / RFP MarqueurVG40254-ANRCHF410
    HIV-1 (group N, strain 06CM-U14296) gag ORF mammalian expression plasmid, C-Flag MarqueurVG40254-CFCHF380
    HIV-1 (group N, strain 06CM-U14296) gag ORF mammalian expression plasmid, C-His MarqueurVG40254-CHCHF380
    HIV-1 (group N, strain 06CM-U14296) gag ORF mammalian expression plasmid, C-Myc MarqueurVG40254-CMCHF380
    HIV-1 (group N, strain 06CM-U14296) gag ORF mammalian expression plasmid, C-HA MarqueurVG40254-CYCHF380
    HIV-1 (group N, strain 06CM-U14296) gag ORF mammalian expression plasmid (Codon Optimized)VG40254-GCHF140
    HIV-1 (group N, strain 06CM-U14296) gag ORF mammalian expression plasmid, N-Flag MarqueurVG40254-NFCHF380
    HIV-1 (group N, strain 06CM-U14296) gag ORF mammalian expression plasmid, N-His MarqueurVG40254-NHCHF380
    HIV-1 (group N, strain 06CM-U14296) gag ORF mammalian expression plasmid, N-Myc MarqueurVG40254-NMCHF380
    HIV-1 (group N, strain 06CM-U14296) gag ORF mammalian expression plasmid, N-HA MarqueurVG40254-NYCHF380
    HIV-1 (group N, strain 06CM-U14296) gag natural ORF mammalian expression plasmidVG40254-UTCHF380
     En savoir plus sur les vecteurs d'expression
    Product nameProduct name
    Size / Price
    Catalogue : VG40254-CY
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Ajouter au panierBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.