After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

HIV-1 (group N, strain 06CM-U14296) gag ORF mammalian expression plasmid, C-HA Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
HIV HIV-gag Informations sur les produits clonés de cDNA
Gene_bank_ref_id:GQ324962.1
Taille du ADNc:1536bp
Description du ADNc:Full length Clone DNA of HIV-1 (group N, strain 06CM-U14296) gag with C terminal HA tag.
Synonyme du gène:HIV-gag
Espèces:HIV
Vecteur:pCMV3-C-HA
Plasmid:
Site de restriction:
Séquence du marqueur:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Description de la séquence:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at ambient temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

HIV-1 (group N, strain 06CM-U14296) gag ORF mammalian expression plasmid, C-HA Marqueur on other vectors
HIV-1 (group N, strain 06CM-U14296) gag ORF mammalian expression plasmid, C-GFPSpark MarqueurVG40254-ACGCHF410
HIV-1 (group N, strain 06CM-U14296) gag ORF mammalian expression plasmid, C-OFPSpark / RFP MarqueurVG40254-ACRCHF410
HIV-1 (group N, strain 06CM-U14296) gag ORF mammalian expression plasmid, N-GFPSpark MarqueurVG40254-ANGCHF410
HIV-1 (group N, strain 06CM-U14296) gag ORF mammalian expression plasmid, N-OFPSpark / RFP MarqueurVG40254-ANRCHF410
HIV-1 (group N, strain 06CM-U14296) gag ORF mammalian expression plasmid, C-Flag MarqueurVG40254-CFCHF380
HIV-1 (group N, strain 06CM-U14296) gag ORF mammalian expression plasmid, C-His MarqueurVG40254-CHCHF380
HIV-1 (group N, strain 06CM-U14296) gag ORF mammalian expression plasmid, C-Myc MarqueurVG40254-CMCHF380
HIV-1 (group N, strain 06CM-U14296) gag ORF mammalian expression plasmid, C-HA MarqueurVG40254-CYCHF380
HIV-1 (group N, strain 06CM-U14296) gag ORF mammalian expression plasmid (Codon Optimized)VG40254-GCHF140
HIV-1 (group N, strain 06CM-U14296) gag ORF mammalian expression plasmid, N-Flag MarqueurVG40254-NFCHF380
HIV-1 (group N, strain 06CM-U14296) gag ORF mammalian expression plasmid, N-His MarqueurVG40254-NHCHF380
HIV-1 (group N, strain 06CM-U14296) gag ORF mammalian expression plasmid, N-Myc MarqueurVG40254-NMCHF380
HIV-1 (group N, strain 06CM-U14296) gag ORF mammalian expression plasmid, N-HA MarqueurVG40254-NYCHF380
HIV-1 (group N, strain 06CM-U14296) gag natural ORF mammalian expression plasmidVG40254-UTCHF380
 En savoir plus sur les vecteurs d'expression
Product nameProduct name
Size / Price
Catalogue : VG40254-CY
Prix catalogue : 
Prix :      (You Save: )
Taille :
Quantité :+-
Disponibilité2-3 weeks
Bulk Discount RequiryAjouter au panier
Contact Us
Images
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »