After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Commande rapide

Text Size:AAA

HIV-2 (subtype CRF01_AB, strain 07JP_NMC716_clone_01) GP125 ORF mammalian expression plasmid, C-HA Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
HIV GP125 Informations sur les produits clonés de cDNA
Gene_bank_ref_id:AB731740.1
Taille du ADNc:1515bp
Description du ADNc:Full length Clone DNA of HIV-2 (subtype CRF01_AB, strain 07JP_NMC716_clone_01) GP125 (env 6682-8196bp) with C terminal HA tag.
Synonyme du gène:GP125
Espèces:HIV
Vecteur:pCMV3-C-HA
Plasmid:
Site de restriction:
Séquence du marqueur:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Description de la séquence:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at ambient temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

HIV-2 (subtype CRF01_AB, strain 07JP_NMC716_clone_01) GP125 ORF mammalian expression plasmid, C-HA Marqueur on other vectors
HIV-2 (subtype CRF01_AB, strain 07JP_NMC716_clone_01) GP125 ORF mammalian expression plasmid, C-GFPSpark MarqueurVG40261-ACGCHF410
HIV-2 (subtype CRF01_AB, strain 07JP_NMC716_clone_01) GP125 ORF mammalian expression plasmid, C-OFPSpark / RFP MarqueurVG40261-ACRCHF410
HIV-2 (subtype CRF01_AB, strain 07JP_NMC716_clone_01) GP125 ORF mammalian expression plasmid, C-Flag MarqueurVG40261-CFCHF380
HIV-2 (subtype CRF01_AB, strain 07JP_NMC716_clone_01) GP125 ORF mammalian expression plasmid, C-His MarqueurVG40261-CHCHF380
HIV-2 (subtype CRF01_AB, strain 07JP_NMC716_clone_01) GP125 ORF mammalian expression plasmid, C-Myc MarqueurVG40261-CMCHF380
HIV-2 (subtype CRF01_AB, strain 07JP_NMC716_clone_01) GP125 ORF mammalian expression plasmid, C-HA MarqueurVG40261-CYCHF380
HIV-2 (subtype CRF01_AB, strain 07JP_NMC716_clone_01) GP125 ORF mammalian expression plasmid (Codon Optimized)VG40261-GCHF140
HIV-2 (subtype CRF01_AB, strain 07JP_NMC716_clone_01) GP125 ORF mammalian expression plasmid, N-Flag MarqueurVG40261-NFCHF380
HIV-2 (subtype CRF01_AB, strain 07JP_NMC716_clone_01) GP125 ORF mammalian expression plasmid, N-His MarqueurVG40261-NHCHF380
HIV-2 (subtype CRF01_AB, strain 07JP_NMC716_clone_01) GP125 ORF mammalian expression plasmid, N-Myc MarqueurVG40261-NMCHF380
HIV-2 (subtype CRF01_AB, strain 07JP_NMC716_clone_01) GP125 ORF mammalian expression plasmid, N-HA MarqueurVG40261-NYCHF380
HIV-2 (subtype CRF01_AB, strain 07JP_NMC716_clone_01) GP125 natural ORF mammalian expression plasmidVG40261-UTCHF380
 En savoir plus sur les vecteurs d'expression
Product nameProduct name
Size / Price
Catalogue : VG40261-CY
Prix catalogue : 
Prix :      (You Save: )
Taille :
Quantité :+-
Disponibilité2-3 weeks
Bulk Discount RequiryAjouter au panier
Contact Us
Images
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »