After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Humain Acetoacetyl-CoA Synthetase expression plasmide de Gène l'ADNc ORF clone, C-His Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Human AACS Informations sur les produits clonés de cDNA
Gene_bank_ref_id:NM_023928.3
Taille du ADNc:2019bp
Description du ADNc:Full length Clone DNA of Homo sapiens acetoacetyl-CoA synthetase with C terminal His tag.
Synonyme du gène:ACSF1, SUR-5, FLJ12389, FLJ41251, AACS
Espèces:Human
Vecteur:pCMV3-C-His
Plasmid:
Site de restriction:
Séquence du marqueur:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Description de la séquence:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Humain Acetoacetyl-CoA Synthetase expression plasmide de Gène l'ADNc ORF clone, C-His Marqueur on other vectors
Humain Acetoacetyl-CoA Synthetase expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurHG11117-ACGCHF290
Humain Acetoacetyl-CoA Synthetase expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurHG11117-ACRCHF290
Humain Acetoacetyl-CoA Synthetase expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurHG11117-ANGCHF290
Humain Acetoacetyl-CoA Synthetase expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurHG11117-ANRCHF290
Humain Acetoacetyl-CoA Synthetase expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG11117-CFCHF260
Humain Acetoacetyl-CoA Synthetase expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurHG11117-CHCHF260
Humain Acetoacetyl-CoA Synthetase expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurHG11117-CMCHF260
Humain Acetoacetyl-CoA Synthetase expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurHG11117-CYCHF260
Humain Acetoacetyl-CoA Synthetase Gène ADNc clone le vecteur de clonageHG11117-MCHF90
Humain Acetoacetyl-CoA Synthetase expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurHG11117-NFCHF260
Humain Acetoacetyl-CoA Synthetase expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurHG11117-NHCHF260
Humain Acetoacetyl-CoA Synthetase expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurHG11117-NMCHF260
Humain Acetoacetyl-CoA Synthetase expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurHG11117-NYCHF260
Humain Acetoacetyl-CoA Synthetase expression plasmide de Gène l'ADNc ORF cloneHG11117-UTCHF260
 En savoir plus sur les vecteurs d'expression
Product nameProduct name
Fond

Acetoacetyl-CoA Synthetase (AACS) is a novel cytosolic ketone body (acetoacetate)-specific ligase. The AACS in adipose tissue plays an important role in utilizing ketone body for the fatty acid-synthesis during adipose tissue development. It had been improved that Acetoacetyl-CoA Synthetase is an essential enzyme for the synthesis of fatty acid and cholesterol from ketone bodies, was found to be highly expressed in mouse adipose tissue, and GC box and C/EBPs motif were crucial for AACS promoter activity in 3T3-L1 adipocytes. Moreover, AACS promoter activity was controlled mainly by C/EBPalpha during adipogenesis. AACS gene expression is particularly abundant in white adipose tissue, as it is induced during adipocyte differentiation. The human AACS promoter is a PPARgamma target gene and that this nuclear receptor is recruited to the AACS promoter by direct interaction with Sp1 (stimulating protein-1). The Acetoacetyl-CoA Synthetase has important roles in the regulation of ketone body utilization in rat liver and that these hypocholesterolemic agents have the ability to remedy the impaired utilization of ketone bodies under the diabetic condition.

Références
  • Aguil F, et al. (2010) Transcriptional regulation of the human acetoacetyl-CoA synthetase gene by PPARgamma. Biochem J. 427(2): 255-64.
  • Hasegawa S, et al. (2008) Transcriptional regulation of ketone body-utilizing enzyme, acetoacetyl-CoA synthetase, by C/EBPalpha during adipocyte differentiation. Biochim Biophys Acta. 1779(6-7): 414-9.
  • Sato H, et al. (2002) Effects of streptozotocin-induced diabetes on acetoacetyl-CoA synthetase activity in rats. Biochem Pharmacol. 63(10): 1851-5.
  • Size / Price
    Catalogue : HG11117-CH
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
    Images
        Articles consultés récemment
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »