Aggrecan / ACAN cDNA ORF Clone, Human, N-DDK (Flag®) tag

This product is not available, please contact order_us@sinobiological.com for relevant product if required.

Aggrecan / ACAN cDNA ORF Clone, Human, N-DDK (Flag®) tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2028 bp
Description
Full length Clone DNA of Human aggrecan with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Aggrecan / ACAN cDNA ORF Clone, Human, N-DDK (Flag®) tag: Alternative Names

AGC1 cDNA ORF Clone, Human; AGCAN cDNA ORF Clone, Human; CSPG1 cDNA ORF Clone, Human; CSPGCP cDNA ORF Clone, Human; MSK16 cDNA ORF Clone, Human; SEDK cDNA ORF Clone, Human

Aggrecan / ACAN Background Information

ACAN (Aggrecan) is a high molecular weight proteoglycan that plays a critical role in cartilage structure and the function of joints, providing intervertebral disc and cartilage with the ability to resist compressive loads. Aggrecan is the major structural proteoglycan in the extracellular matrix of the intervertebral disc. It is large, possessing numerous glycosaminoglycan chains and the ability to form aggregates in association with hyaluronan. The negatively charged glycosaminoglycan side chains in aggrecan in the nucleus pulposus of the intervertebral discs can bind electrostatically to polar water molecules, which are crucial for maintaining the well-hydrated state that enables the discs to undergo reversible deformation under compressive loading. aggrecan plays a central role in the function and degeneration of the intervertebral disc, which may suggest potential aggrecan-based therapies for disc regeneration.
Full Name
aggrecan
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait