ACAT2 cDNA ORF Clone, Human, untagged

Cat: HG15552-UT

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All ACAT2 Reagents

CRO Services

Product recommended


All ACAT2 Reagents

ACAT2 cDNA ORF Clone, Human, untagged General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
1194 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human acetyl-CoA acetyltransferase 2.

Plasmid

Promoter
Enhanced CMV promoter
Restriction Sites
KpnI + XbaI(6.1kb+1.19kb)
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

ACAT2 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ACAT2 cDNA ORF Clone, Human, untagged Validated Images

other Green fluorescent protein / GFP Gene Plasmid Map 5613

ACAT2 Background Information

Full Name
acetyl-CoA acetyltransferase 2

ACAT2 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
ACAT2 cDNA ORF Clone in Cloning Vector, Rat RG80686-U
ACAT2 cDNA ORF Clone, Rat, untagged RG80686-UT
ACAT2 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80686-ACG
ACAT2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80686-ACGLN
ACAT2 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80686-ANG
ACAT2 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80686-ACR
ACAT2 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80686-ANR
ACAT2 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80686-CF
ACAT2 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80686-NF
ACAT2 cDNA ORF Clone, Rat, C-His tag RG80686-CH
ACAT2 cDNA ORF Clone, Rat, N-His tag RG80686-NH
ACAT2 cDNA ORF Clone, Rat, C-HA tag RG80686-CY
ACAT2 cDNA ORF Clone, Rat, N-HA tag RG80686-NY
ACAT2 cDNA ORF Clone, Rat, C-Myc tag RG80686-CM
ACAT2 cDNA ORF Clone, Rat, N-Myc tag RG80686-NM
ACAT2 qPCR Primer Pairs, Rat RP300650

ACAT2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
ACAT2 cDNA ORF Clone in Cloning Vector, Mouse MG52596-G
ACAT2 cDNA ORF Clone, Mouse, untagged MG52596-UT
ACAT2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52596-ACGLN
ACAT2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52596-ACG
ACAT2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52596-ANG
ACAT2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52596-ACR
ACAT2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52596-ANR
ACAT2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52596-CF
ACAT2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52596-NF
ACAT2 cDNA ORF Clone, Mouse, C-His tag MG52596-CH
ACAT2 cDNA ORF Clone, Mouse, N-His tag MG52596-NH
ACAT2 cDNA ORF Clone, Mouse, C-HA tag MG52596-CY
ACAT2 cDNA ORF Clone, Mouse, N-HA tag MG52596-NY
ACAT2 cDNA ORF Clone, Mouse, C-Myc tag MG52596-CM
ACAT2 cDNA ORF Clone, Mouse, N-Myc tag MG52596-NM
ACAT2 qPCR Primer Pairs, Mouse MP202467

ACAT2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
ACAT2 cDNA ORF Clone in Cloning Vector, Human HG15552-G
ACAT2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15552-ACGLN
ACAT2 cDNA ORF Clone, Human, C-GFPSpark® tag HG15552-ACG
ACAT2 cDNA ORF Clone, Human, N-GFPSpark® tag HG15552-ANG
ACAT2 cDNA ORF Clone, Human, C-OFPSpark® tag HG15552-ACR
ACAT2 cDNA ORF Clone, Human, N-OFPSpark® tag HG15552-ANR
ACAT2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15552-CF
ACAT2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15552-NF
ACAT2 cDNA ORF Clone, Human, C-His tag HG15552-CH
ACAT2 cDNA ORF Clone, Human, N-His tag HG15552-NH
ACAT2 cDNA ORF Clone, Human, C-HA tag HG15552-CY
ACAT2 cDNA ORF Clone, Human, N-HA tag HG15552-NY
ACAT2 cDNA ORF Clone, Human, C-Myc tag HG15552-CM
ACAT2 cDNA ORF Clone, Human, N-Myc tag HG15552-NM
ACAT2 qPCR Primer Pairs, Human HP104172
info info
添加购物车成功! 添加购物车失败!