After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Humain ACO1/irp1 expression plasmide de Gène l'ADNc ORF clone, C-Flag Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Human ACO1 Informations sur les produits clonés de cDNA
Gene_bank_ref_id:NM_002197.2
Taille du ADNc:2670bp
Description du ADNc:Full length Clone DNA of Homo sapiens aconitase 1, soluble with C terminal Flag tag.
Synonyme du gène:IRP1, ACONS, IREB1, IREBP, IREBP1,
Espèces:Human
Vecteur:pCMV3-C-FLAG
Plasmid:
Site de restriction:
Séquence du marqueur:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Description de la séquence:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Humain ACO1/irp1 expression plasmide de Gène l'ADNc ORF clone, C-Flag Marqueur on other vectors
Product nameProduct name
Fond

Aconitase 1(ACO1) or IRP1 is one member of the aconitase family that contains a diverse group of iron-sulphur(Fe-S) isomerases and two types of iron regulatory protein. Aconitase exits in two forms: one is soluble and the other is mitochondrial. ACO1 is the soluble existing form, and the mitochondrial form is ACO2. Residues from all three N-terminal domains and the larger C-terminal domain contribute to the active site region. When the enzyme is activated, it gains an additional iron atom. ACO1 can assume two different functions in cells, depending on different conditions. During iron scarcity or oxidative stress, ACO1 binds to mRNA stem-loop structures called iron responsive elements to modulate the translation of iron metabolism genes. In iron-rich conditions, ACO1 binds an iron-sulfur cluster to function as a cytosolic aconitase. 

Références
  • Robbins AH, et al. (1989) The structure of aconitase. Proteins: Structure, Function, and Bioinformatics. 5 (4): 289-312.
  • Volz K. (2008) The functional duality of iron regulatory protein 1. Curr Opin Struct Biol. 18 (1): 106-11.
  • Gruer MJ, et al. (1997) The aconitase family: three structural variations on a common theme. Trends Biochem Sci. 22 (1): 3-6.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »