Commande rapide

Humain Acyl-CoA Thioesterase 9 expression plasmide de Gène l'ADNc ORF clone

Fiche techniqueCommentairesProduits apparentésProtocoles
Human ACOT9 Informations sur les produits clonés de cDNA
Gene_bank_ref_id:BC012573
Taille du ADNc:639bp
Description du ADNc:Full length Clone DNA of Homo sapiens acyl-CoA thioesterase 9.
Synonyme du gène:CGI-16, ACATE2, MT-ACT48, MTACT48, ACOT9
Espèces:Human
Vecteur:pCMV3-untagged
Plasmid:
Site de restriction:
Séquence du marqueur:
Description de la séquence:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Humain Acyl-CoA Thioesterase 9 expression plasmide de Gène l'ADNc ORF clone on other vectors
Humain Acyl-CoA Thioesterase 9 expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurHG14234-ACGCHF270
Humain Acyl-CoA Thioesterase 9 expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurHG14234-ACRCHF270
Humain Acyl-CoA Thioesterase 9 expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurHG14234-ANGCHF270
Humain Acyl-CoA Thioesterase 9 expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurHG14234-ANRCHF270
Humain Acyl-CoA Thioesterase 9 expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG14234-CFCHF230
Humain Acyl-CoA Thioesterase 9 expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurHG14234-CHCHF230
Humain Acyl-CoA Thioesterase 9 expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurHG14234-CMCHF230
Humain Acyl-CoA Thioesterase 9 expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurHG14234-CYCHF230
Humain Acyl-CoA Thioesterase 9 Gène ADNc clone le vecteur de clonageHG14234-GCHF90
Humain Acyl-CoA Thioesterase 9 expression plasmide de Gène l'ADNc ORF cloneHG14234-G-NCHF230
Humain Acyl-CoA Thioesterase 9 expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurHG14234-NFCHF230
Humain Acyl-CoA Thioesterase 9 expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurHG14234-NHCHF230
Humain Acyl-CoA Thioesterase 9 expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurHG14234-NMCHF230
Humain Acyl-CoA Thioesterase 9 expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurHG14234-NYCHF230
Humain Acyl-CoA Thioesterase 9 expression plasmide de Gène l'ADNc ORF cloneHG14234-UTCHF230
 En savoir plus sur les vecteurs d'expression
Product nameProduct name
Size / Price
Catalogue : HG14234-UT
Prix catalogue : 
Prix :      (You Save: )
Taille :
Quantité :+-
Disponibilité2-3 weeks
Bulk Discount RequiryAjouter au panier
Contact Us
Images
      Articles consultés récemment
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »