Commande rapide

Text Size:AAA

Humain TRACP/ACP5 transcript variant 4 expression plasmide de Gène l'ADNc ORF clone, N-Flag Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Human ACP5 Informations sur les produits clonés de cDNA
Taille du ADNc:978bp
Description du ADNc:Full length Clone DNA of Homo sapiens acid phosphatase 5, tartrate resistant , transcript variant 4 with N terminal Flag tag.
Synonyme du gène:TRAP, MGC117378
Site de restriction:
Séquence du marqueur:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Description de la séquence:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Humain TRACP/ACP5 transcript variant 4 expression plasmide de Gène l'ADNc ORF clone, N-Flag Marqueur on other vectors
Humain TRACP/ACP5 transcript variant 4 expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurHG10550-ACGCHF270
Humain TRACP/ACP5 transcript variant 4 expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurHG10550-ACRCHF270
Humain TRACP/ACP5 transcript variant 4 expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG10550-CFCHF230
Humain TRACP/ACP5 transcript variant 4 expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurHG10550-CHCHF230
Humain TRACP/ACP5 transcript variant 4 expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurHG10550-CMCHF230
Humain TRACP/ACP5 transcript variant 4 expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurHG10550-CYCHF230
Humain TRACP/ACP5 transcript variant 4 Gène ADNc clone le vecteur de clonageHG10550-MCHF90
Humain TRACP/ACP5 transcript variant 4 expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG10550-M-FCHF230
Humain TRACP/ACP5 transcript variant 4 expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurHG10550-NFCHF230
Humain TRACP/ACP5 transcript variant 4 expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurHG10550-NHCHF230
Humain TRACP/ACP5 transcript variant 4 expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurHG10550-NMCHF230
Humain TRACP/ACP5 transcript variant 4 expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurHG10550-NYCHF230
Humain TRACP/ACP5 transcript variant 4 expression plasmide de Gène l'ADNc ORF cloneHG10550-UTCHF230
 En savoir plus sur les vecteurs d'expression
Product nameProduct name

Tartrate-resistant acid phosphatase (TRACP) or acid phosphatase 5, tartrate resistant (ACP5 or TRAP) is a glycosylated monomeric metalloenzyme expressed in mammals. TRACP is associated with osteoblast migration to bone resorption sites, and, once there, TRACP is believed to initiate osteoblast differentiation, activation, and proliferation. TRACP once considered to be just a histochemical marker of osteoclasts is now recognised to be a molecule of widespread occurrence with functions in both the skeleton and the immune system. Two forms of TRACP circulate in human blood, TRACP 5a derived from macrophages and dendritic cells, and TRACP-5b derived from osteoclasts. Recent data have demonstrated the utility of TRACP-5b as a marker of osteoclast number and bone resorption, and serum TRACP-5a as a marker of inflammatory conditions. TRACP is expressed by osteoclasts, macrophages, dendritic cells and a number of other cell types. It has a critical role in many biological processes including skeletal development, collagen synthesis and degradation, the mineralisation of bone, cytokine production by macrophages and dendritic cells, macrophage recruitment, dendritic cell maturation and a role in the development of Th1 responses.

  • Hayman AR. (2008) Tartrate-resistant acid phosphatase (TRAP) and the osteoclast/immune cell dichotomy. Autoimmunity. 41(3): 218-23.
  • Halleen JM, et al. (2006) Tartrate-resistant acid phosphatase 5b (TRACP 5b) as a marker of bone resorption. Clin Lab. 52(9-10): 499-509.
  • Mochizuki Y. (2006) Bone and bone related biochemical examinations. Bone and collagen related metabolites. Tartrate-resistant acid phosphatase (TRACP). Clin Calcium. 16(6): 948-55.
  • Lamp EC, et al. (2000) Biology of tartrate-resistant acid phosphatase. Leuk Lymphoma. 39(5-6): 477-84.
  • Size / Price
    Catalogue : HG10550-NF
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
        Articles consultés récemment
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.