After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Humain ACPL2 expression plasmide de Gène l'ADNc ORF clone, N-Flag Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Human ACPL2 Informations sur les produits clonés de cDNA
Gene_bank_ref_id:NM_152282.3
Taille du ADNc:1443bp
Description du ADNc:Full length Clone DNA of Homo sapiens acid phosphatase-like 2 with N terminal Flag tag.
Synonyme du gène:FLJ23751, ACPL2
Espèces:Human
Vecteur:pCMV3-SP-N-FLAG
Plasmid:
Site de restriction:
Séquence du marqueur:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Description de la séquence:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Fond

acid phosphatase-like protein 2, also known as ACPL2, is a secreted protein which belongs to the histidine acid phosphatase family. A large-scale effort, termed the Secreted Protein Discovery Initiative (SPDI), was undertaken to identify novel secreted and transmembrane proteins. In the first of several approaches, a biological signal sequence trap in yeast cells was utilized to identify cDNA clones encoding putative secreted proteins. A second strategy utilized various algorithms that recognize features such as the hydrophobic properties of signal sequences to identify putative proteins encoded by expressed sequence tags (ESTs) from human cDNA libraries. A third approach surveyed ESTs for protein sequence similarity to a set of known receptors and their ligands with the BLAST algorithm. Finally, both signal-sequence prediction algorithms and BLAST were used to identify single exons of potential genes from within human genomic sequence.

Références
  • Clark HF., et al., 2003, Genome Res. 13: 2265-70.
  • Ota T.et al., 2004, Nat. Genet. 36:40-5.
  • Size / Price
    Catalogue : HG11243-NF
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »