Commande rapide

Humain beta Actin/ACTB expression plasmide de Gène l'ADNc ORF clone, C-Flag Marqueur

  • Human ACTB Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged
Fiche techniqueCommentairesProduits apparentésProtocoles
Humain ACTB Informations sur les produits clonés de cDNA
Taille du ADNc:1128bp
Description du ADNc:Full length Clone DNA of Homo sapiens actin, beta with C terminal Flag tag.
Synonyme du gène:PS1TP5BP1
Site de restriction:KpnI + XbaI (6kb + 1.18kb)
Séquence du marqueur:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Description de la séquence:Identical with the Gene Bank Ref. ID sequence.
( We provide with ACTB qPCR primers for gene expression analysis, HP100001 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Humain ACTB Gene Plasmid Map
Human ACTB Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Humain beta Actin/ACTB expression plasmide de Gène l'ADNc ORF clone, C-Flag Marqueur on other vectors
Humain beta Actin/ACTB expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurHG10962-ACGCHF270
Humain beta Actin/ACTB expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurHG10962-ACRCHF270
Humain beta Actin/ACTB expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurHG10962-ANGCHF270
Humain beta Actin/ACTB expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurHG10962-ANRCHF270
Humain beta Actin/ACTB expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG10962-CFCHF230
Humain beta Actin/ACTB expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurHG10962-CHCHF230
Humain beta Actin/ACTB expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurHG10962-CMCHF230
Humain beta Actin/ACTB expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurHG10962-CYCHF230
Humain beta Actin/ACTB Gène ADNc clone le vecteur de clonageHG10962-MCHF90
Humain beta Actin/ACTB expression plasmide de Gène l'ADNc ORF cloneHG10962-M-NCHF230
Humain beta Actin/ACTB expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurHG10962-NFCHF230
Humain beta Actin/ACTB expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurHG10962-NHCHF230
Humain beta Actin/ACTB expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurHG10962-NMCHF230
Humain beta Actin/ACTB expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurHG10962-NYCHF230
Humain beta Actin/ACTB expression plasmide de Gène l'ADNc ORF cloneHG10962-UTCHF230
 En savoir plus sur les vecteurs d'expression
Product nameProduct name
Size / Price
Catalogue : HG10962-CF
Prix catalogue : 
Prix :      (You Save: )
Taille :
Quantité :+-
Ajouter au panierBulk Discount Requiry

Datasheet & Documentation

Contact Us
    Articles consultés récemment
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.