After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Commande rapide

Text Size:AAA

Humain Alpha-actinin-2/ACTN2 expression plasmide de Gène l'ADNc ORF clone, C-Flag Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Human ACTN2 Informations sur les produits clonés de cDNA
Gene_bank_ref_id:NM_001103.2
Taille du ADNc:2685bp
Description du ADNc:Full length Clone DNA of Homo sapiens actinin, alpha 2 with C terminal Flag tag.
Synonyme du gène:CMD1AA,
Espèces:Human
Vecteur:pCMV3-C-FLAG
Plasmid:pCMV3-ACTN2-Flag
Site de restriction:KpnI + XbaI (6kb + 2.72kb)
Séquence du marqueur:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Description de la séquence:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Human ACTN2 Gene Plasmid Map
Human ACTN2 natural ORF mammalian expression plasmid, C-Flag tag
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Humain Alpha-actinin-2/ACTN2 expression plasmide de Gène l'ADNc ORF clone, C-Flag Marqueur on other vectors
Humain Alpha-actinin-2/ACTN2 expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurHG10972-ACGCHF390
Humain Alpha-actinin-2/ACTN2 expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurHG10972-ACRCHF390
Humain Alpha-actinin-2/ACTN2 expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurHG10972-ANGCHF390
Humain Alpha-actinin-2/ACTN2 expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurHG10972-ANRCHF390
Humain Alpha-actinin-2/ACTN2 expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG10972-CFCHF350
Humain Alpha-actinin-2/ACTN2 expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurHG10972-CHCHF350
Humain Alpha-actinin-2/ACTN2 expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurHG10972-CMCHF350
Humain Alpha-actinin-2/ACTN2 expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurHG10972-CYCHF350
Humain Alpha-actinin-2/ACTN2 Gène ADNc clone le vecteur de clonageHG10972-MCHF90
Humain Alpha-actinin-2/ACTN2 expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurHG10972-M-MCHF350
Humain Alpha-actinin-2/ACTN2 expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurHG10972-NFCHF350
Humain Alpha-actinin-2/ACTN2 expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurHG10972-NHCHF350
Humain Alpha-actinin-2/ACTN2 expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurHG10972-NMCHF350
Humain Alpha-actinin-2/ACTN2 expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurHG10972-NYCHF350
Humain Alpha-actinin-2/ACTN2 expression plasmide de Gène l'ADNc ORF cloneHG10972-UTCHF350
 En savoir plus sur les vecteurs d'expression
Product nameProduct name
Size / Price
Catalogue : HG10972-CF
Prix catalogue : 
Prix :      (You Save: )
Taille :
Quantité :+-
DisponibilitéIn Stock
Bulk Discount RequiryAjouter au panier
Contact Us
Images
  • Human ACTN2 natural ORF mammalian expression plasmid, C-Flag tag
  • Human CDK5 ORF mammalian expression plasmid, C-Flag tag
    Articles consultés récemment
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »