Commande rapide

Humain Aminoacylase-1/ACY1 expression plasmide de Gène l'ADNc ORF clone, N-Flag Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Human ACY1 Informations sur les produits clonés de cDNA
Gene_bank_ref_id:NM_000666.1
Taille du ADNc:1227bp
Description du ADNc:Full length Clone DNA of Homo sapiens aminoacylase 1 with N terminal Flag tag.
Synonyme du gène:ACY1D, ACYLASE
Espèces:Human
Vecteur:pCMV3-N-FLAG
Plasmid:
Site de restriction:
Séquence du marqueur:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Description de la séquence:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Humain Aminoacylase-1/ACY1 expression plasmide de Gène l'ADNc ORF clone, N-Flag Marqueur on other vectors
Humain Aminoacylase-1/ACY1 expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurHG10549-ACGCHF270
Humain Aminoacylase-1/ACY1 expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurHG10549-ACRCHF270
Humain Aminoacylase-1/ACY1 expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurHG10549-ANGCHF270
Humain Aminoacylase-1/ACY1 expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurHG10549-ANRCHF270
Humain Aminoacylase-1/ACY1 expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG10549-CFCHF234
Humain Aminoacylase-1/ACY1 expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurHG10549-CHCHF234
Humain Aminoacylase-1/ACY1 expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurHG10549-CMCHF234
Humain Aminoacylase-1/ACY1 expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurHG10549-CYCHF234
Humain Aminoacylase-1/ACY1 Gène ADNc clone le vecteur de clonageHG10549-MCHF90
Humain Aminoacylase-1/ACY1 expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG10549-M-FCHF234
Humain Aminoacylase-1/ACY1 expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurHG10549-NFCHF234
Humain Aminoacylase-1/ACY1 expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurHG10549-NHCHF234
Humain Aminoacylase-1/ACY1 expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurHG10549-NMCHF234
Humain Aminoacylase-1/ACY1 expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurHG10549-NYCHF234
Humain Aminoacylase-1/ACY1 expression plasmide de Gène l'ADNc ORF cloneHG10549-UTCHF234
 En savoir plus sur les vecteurs d'expression
Product nameProduct name
Fond

Aminoacylase 1 (ACY1), a metalloenzyme that removes amide-linked ACY1 groups from amino acids and may play a role in regulating responses to oxidative stress. Both the C-terminal fragment found in the two-hybrid screen and full-length ACY1 co-immunoprecipitate with SphK1. Though both C-terminal and full-length proteins slightly reduce SphK1 activity measured in vitro, the C-terminal fragment inhibits while full-length ACY1 potentiates the effects of SphK1 on proliferation and apoptosis. It suggested that ACY1 physically interacts with SphK1 and may influence its physiological functions. As a homodimeric zinc-binding enzyme, Aminoacylase 1 catalyzes the hydrolysis of N alpha-acylated amino acids. Deficiency of Aminoacylase 1 due to mutations in the Aminoacylase 1 (ACY1) gene follows an autosomal-recessive trait of inheritance and is characterized by accumulation of N-acetyl amino acids in the urine.

Références
  • Sommer A, et al. (2011) The molecular basis of aminoacylase 1 deficiency. Biochim Biophys Acta. 1812(6): 685-90.
  • Maceyka M, et al. (2004) Aminoacylase 1 is a sphingosine kinase 1-interacting protein. FEBS Lett. 568(1-3): 30-4.
  • Cook RM, et al.(1993) Human aminoacylase-1. Cloning, sequence, and expression analysis of a chromosome 3p21 gene inactivated in small cell lung cancer. J Biol Chem. 268(23): 17010-7.
  • Size / Price
    Catalogue : HG10549-NF
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »