Commande rapide

Humain ADAMTSL1 expression plasmide de Gène l'ADNc ORF clone, C-Myc Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Human ADAMTSL1 Informations sur les produits clonés de cDNA
Taille du ADNc:1320bp
Description du ADNc:Full length Clone DNA of Homo sapiens ADAMTS-like 1 with C terminal Myc tag.
Synonyme du gène:C9orf94, PUNCTIN, ADAMTSR1, ADAMTSL-1, ADAMTSL1
Site de restriction:
Séquence du marqueur:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Description de la séquence:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name

ADAMTSL1 is a secreted molecule resembling members of the ADAMTS protein family of matrix metalloproteinases. Both ADAMTS proteins and ADAM protein family contain a disintegrin and a metalloprotease domain. Metallospondins is collective term for members of ADAMTS protein family. ADAMTS proteins lack the EGF-like domain found normally in members of the ADAM protein family. They also do not possess the canonical disintegrin sequence found in the ADAM protein family. It contains the domains found in members of the ADAMTS protein family with the exception of the pro-metalloprotease and the disintegrin-like domain typical of this family. ADAMTSL1 gene is expressed in adult skeletal muscle. ADAMTSL1 may play an important role in the extracellular matrix as it is deposited in the cell substratum in a punctate fashion and is excluded from focal contacts.

  • Hirohata S, et al. (2002) Punctin, a novel ADAMTS-like molecule, ADAMTSL-1, in extracellular matrix. J Biol Chem. 277 (14): 12182-9.
  • Wang LW, et al. (2007) O-fucosylation of thrombospondin type 1 repeats in ADAMTS-like-1/punctin-1 regulates secretion: implications for the ADAMTS superfamily. J Biol Chem. 282 (23): 17024-31.
  • Hall NG, et al. (2004) ADAMTSL-3/punctin-2, a novel glycoprotein in extracellular matrix related to the ADAMTS family of metalloproteases. Matrix Biol. 22 (6): 501-10.
  • Size / Price
    Catalogue : HG13550-CM
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
        Articles consultés récemment
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.