Commande rapide

Text Size:AAA

Humain ADAP1/centaurin-alpha expression plasmide de Gène l'ADNc ORF clone, N-His Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Human ADAP1 Informations sur les produits clonés de cDNA
Taille du ADNc:1125bp
Description du ADNc:Full length Clone DNA of Homo sapiens ArfGAP with dual PH domains 1 with N terminal His tag.
Synonyme du gène:GCS1L, CENTA1, p42IP4, ADAP1
Site de restriction:
Séquence du marqueur:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Description de la séquence:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Humain ADAP1/centaurin-alpha expression plasmide de Gène l'ADNc ORF clone, N-His Marqueur on other vectors
Humain ADAP1/centaurin-alpha expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurHG12301-ACGCHF270
Humain ADAP1/centaurin-alpha expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurHG12301-ACRCHF270
Humain ADAP1/centaurin-alpha expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurHG12301-ANGCHF270
Humain ADAP1/centaurin-alpha expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurHG12301-ANRCHF270
Humain ADAP1/centaurin-alpha expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG12301-CFCHF234
Humain ADAP1/centaurin-alpha expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurHG12301-CHCHF234
Humain ADAP1/centaurin-alpha expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurHG12301-CMCHF234
Humain ADAP1/centaurin-alpha expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurHG12301-CYCHF234
Humain ADAP1/centaurin-alpha Gène ADNc clone le vecteur de clonageHG12301-GCHF90
Humain ADAP1/centaurin-alpha expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurHG12301-NFCHF234
Humain ADAP1/centaurin-alpha expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurHG12301-NHCHF234
Humain ADAP1/centaurin-alpha expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurHG12301-NMCHF234
Humain ADAP1/centaurin-alpha expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurHG12301-NYCHF234
Humain ADAP1/centaurin-alpha expression plasmide de Gène l'ADNc ORF cloneHG12301-UTCHF234
 En savoir plus sur les vecteurs d'expression
Product nameProduct name
Size / Price
Catalogue : HG12301-NH
Prix catalogue : 
Prix :      (You Save: )
Taille :
Quantité :+-
Disponibilité2-3 weeks
Bulk Discount RequiryAjouter au panier
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.