ADK cDNA ORF Clone, Human, C-HA tag

1/1
Price:
Size:
Number:

ADK cDNA ORF Clone, Human, C-HA tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1080 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human adenosine kinase with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Restriction Sites
KpnI + XbaI(6kb+1.08kb)
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

ADK cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ADK cDNA ORF Clone, Human, C-HA tag: Validated Images

ADK cDNA ORF Clone, Human, C-HA tag: Alternative Names

AK cDNA ORF Clone, Human

ADK Background Information

Adenosine kinase(ADK) belongs to the family of transferases. Adenosine kinase (ADK) is the key enzyme in adenosine metabolism and catalyzes ATP and adenosine into two products: ADP and AMP. Two isoforms of the enzyme adenosine kinase (ADK), which differ at their N-terminal ends, are found in mammalian cells. It has been shown that the two ADK isoforms differ only in their first exons and the promoter regions; hence they arise via differential splicing of their first exons with the other exons common to both isoforms. In adult brain, ADK is primarily present in astrocytes. Several lines of experimental evidence support a critical role of ADK in different types of brain injury associated with astrogliosis, which is also a prominent morphologic feature of temporal lobe epilepsy (TLE). It has been suggested that dysregulation of ADK in astrocytes is a common pathologic hallmark of TLE. Moreover, in vitro data suggest the existence of an additional layer of modulatory crosstalk between the astrocyte-based adenosine cycle and inflammation. ADK also contributes to CK homeostasis in vivo.
Full Name
adenosine kinase
References
  • Aronica E, et al. (2011) Upregulation of adenosine kinase in astrocytes in experimental and human temporal lobe epilepsy. Epilepsia.52 (9): 1645-55.
  • Kuettel S, et al. (2011) Crystal structures of T. b. rhodesiense adenosine kinase complexed with inhibitor and activator: implications for catalysis and hyperactivation. PLoS Negl Trop Dis. 5 (5): e1164.
  • Cui XA, et al. (2011) Molecular characterization of Chinese hamster cells mutants affected in adenosine kinase and showing novel genetic and biochemical characteristics. BMC Biochem. 12 (1): 22.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait