Commande rapide

Text Size:AAA

Humain Adrenomedullin / ADM expression plasmide de Gène l'ADNc ORF clone, C-Flag Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Human ADM Informations sur les produits clonés de cDNA
Taille du ADNc:558bp
Description du ADNc:Full length Clone DNA of Homo sapiens adrenomedullin with C terminal Flag tag.
Synonyme du gène:AM, ADM
Site de restriction:
Séquence du marqueur:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Description de la séquence:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name

Adrenomedullin consists of 52 amino acids and is a member of the adrenomedullin family. It s a a hypotensive peptide and has 1 intramolecular disulfide bond. It seems that adrenomedullin has a slight homology with the calcitonin gene-related peptide. Adrenomedullin has a highly expression in pheochromocytoma and adrenal medulla. It also can be detected in lung, ventricle and kidney tissues. Adrenomedullin and PAMP are potent hypotensive and vasodilatator agents. Numerous actions have been reported most related to the physiologic control of fluid and electrolyte homeostasis. In the kidney, adrenomedullin is diuretic and natriuretic, and both adrenomedullin and PAMP inhibit aldosterone secretion by direct adrenal actions. In pituitary gland, both peptides at physiologically relevant doses inhibit basal ACTH secretion. Both peptides appear to act in brain and pituitary gland to facilitate the loss of plasma volume, actions which complement their hypotensive effects in blood vessels. It is believed that adrenomedullin functions through combinations of the calcitonin receptor like receptor and receptor activity-modifying proteins complexes, as well as CGRP receptors.

  • Hao SL, et al. (2011) The antifibrosis effect of adrenomedullin in human lung fibroblasts. Exp Lung Res. 37(10):615-26.
  • Hikosaka T, et al. (2011) Adrenomedullin production is increased in colorectal adenocarcinomas; its relation to matrix metalloproteinase-9. Peptides. 32(9):1825-31.
  • Boc-Zalewska A, et al. (2011) Adrenomedullin mRNA expression in placenta of preeclamptic women. Ginekol Pol. 82(8):585-91.
  • Palladini G, et al. (2011) Midregional proadrenomedullin (MR-proADM) is a powerful predictor of early death in AL amyloidosis. Amyloid. 18(4):216-21.
  • Size / Price
    Catalogue : HG11646-CF
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.