Commande rapide

Humain activity-dependent neuroprotector homeobox expression plasmide de Gène l'ADNc ORF clone, C-His Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Human ADNP Informations sur les produits clonés de cDNA
Taille du ADNc:3309bp
Description du ADNc:Full length Clone DNA of Homo sapiens activity-dependent neuroprotector homeobox with C terminal His tag.
Synonyme du gène:ADNP1, KIAA0784, ADNP
Site de restriction:
Séquence du marqueur:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Description de la séquence:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Humain activity-dependent neuroprotector homeobox expression plasmide de Gène l'ADNc ORF clone, C-His Marqueur on other vectors
Humain activity-dependent neuroprotector homeobox expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurHG11106-ACGCHF390
Humain activity-dependent neuroprotector homeobox expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurHG11106-ACRCHF390
Humain activity-dependent neuroprotector homeobox expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurHG11106-ANGCHF390
Humain activity-dependent neuroprotector homeobox expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurHG11106-ANRCHF390
Humain activity-dependent neuroprotector homeobox expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG11106-CFCHF354
Humain activity-dependent neuroprotector homeobox expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurHG11106-CHCHF354
Humain activity-dependent neuroprotector homeobox expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurHG11106-CMCHF354
Humain activity-dependent neuroprotector homeobox expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurHG11106-CYCHF354
Humain activity-dependent neuroprotector homeobox Gène ADNc clone le vecteur de clonageHG11106-MCHF90
Humain activity-dependent neuroprotector homeobox expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurHG11106-NFCHF354
Humain activity-dependent neuroprotector homeobox expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurHG11106-NHCHF354
Humain activity-dependent neuroprotector homeobox expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurHG11106-NMCHF354
Humain activity-dependent neuroprotector homeobox expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurHG11106-NYCHF354
Humain activity-dependent neuroprotector homeobox expression plasmide de Gène l'ADNc ORF cloneHG11106-UTCHF354
 En savoir plus sur les vecteurs d'expression
Product nameProduct name
Size / Price
Catalogue : HG11106-CH
Prix catalogue : 
Prix :      (You Save: )
Taille :
Quantité :+-
Disponibilité2-3 weeks
Bulk Discount RequiryAjouter au panier
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.