Commande rapide

Humain AGO1 / Argonaute 1 expression plasmide de Gène l'ADNc ORF clone, N-Flag Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Humain AGO1 Informations sur les produits clonés de cDNA
Gene_bank_ref_id:NM_012199.2
Taille du ADNc:2574bp
Description du ADNc:Full length Clone DNA of Homo sapiens eukaryotic translation initiation factor 2C, 1 with N terminal Flag tag.
Synonyme du gène:Q99, AGO1, EIF2C, GERP95, DKFZp686M13167, EIF2C1
Espèces:Human
Vecteur:pCMV3-N-FLAG
Plasmid:pCMV3-Flag-AGO1
Site de restriction:KpnI + XbaI (6kb + 2.61kb)
Séquence du marqueur:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Description de la séquence:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with AGO1 qPCR primers for gene expression analysis, HP101126 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Humain AGO1 Gene Plasmid Map
Human AGO1 ORF mammalian expression plasmid, N-Flag tag
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Humain AGO1 / Argonaute 1 expression plasmide de Gène l'ADNc ORF clone, N-Flag Marqueur on other vectors
Humain AGO1 / Argonaute 1 expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurHG11225-ACGCHF390
Humain AGO1 / Argonaute 1 expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurHG11225-ACRCHF390
Humain AGO1 / Argonaute 1 expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurHG11225-ANGCHF390
Humain AGO1 / Argonaute 1 expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurHG11225-ANRCHF390
Humain AGO1 / Argonaute 1 expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG11225-CFCHF350
Humain AGO1 / Argonaute 1 expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurHG11225-CHCHF350
Humain AGO1 / Argonaute 1 expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurHG11225-CMCHF350
Humain AGO1 / Argonaute 1 expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurHG11225-CYCHF350
Humain AGO1 / Argonaute 1 Gène ADNc clone le vecteur de clonageHG11225-MCHF90
Humain AGO1 / Argonaute 1 expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG11225-M-FCHF350
Humain AGO1 / Argonaute 1 expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurHG11225-NFCHF350
Humain AGO1 / Argonaute 1 expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurHG11225-NHCHF350
Humain AGO1 / Argonaute 1 expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurHG11225-NMCHF350
Humain AGO1 / Argonaute 1 expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurHG11225-NYCHF350
Humain AGO1 / Argonaute 1 expression plasmide de Gène l'ADNc ORF cloneHG11225-UTCHF350
 En savoir plus sur les vecteurs d'expression
Product nameProduct name
Fond

Protein argonaute-1, also known as eukaryotic translation initiation factor 2C 1, EIF2C1, and AGO1, is a member of the argonaute family and ago subfamily. Protein argonaute-1 in humans is encoded by the EIF2C1 gene. This gene is located on chromosome 1 in a cluster of closely related family members including argonaute 3, and argonaute 4. This genomic region is frequently lost in human cancers such as Wilms tumors, neuroblastoma, and carcinomas of the breast, liver, and colon. The human EIF2C1 gene is ubiquitously expressed at low to medium levels. Differential polyadenylation and splicing result in a complex transcriptional pattern. EIF2C1 protein contains one PAZ domain and one Piwi domain. It is required for RNA-mediated gene silencing (RNAi) and transcriptional gene silencing (TGS) of promoter regions which are complementary to bound short antigene RNAs (agRNAs). EIF2C1 binds to short RNAs such as microRNAs (miRNAs) or short interfering RNAs (siRNAs), and represses the translation of mRNAs which are complementary to them.

Size / Price
Catalogue : HG11225-NF
Prix catalogue : 
Prix :      (You Save: )
Taille :
Quantité :+-
Disponibilité
Ajouter au panierBulk Discount Requiry
Contact Us
Images
  • Human aFGF/FGF1 Gene Plasmid Map 5637
  • Human AGO1 / Argonaute 1 Gene Expression validated Image 16805
  • Human AGO1 ORF mammalian expression plasmid, N-Flag tag
    Articles consultés récemment
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »