After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Humain AHNAK2/AHNAK nucleoprotein 2 expression plasmide de Gène l'ADNc ORF clone

Fiche techniqueCommentairesProduits apparentésProtocoles
Human AHNAK2 Informations sur les produits clonés de cDNA
Gene_bank_ref_id:BC049216
Taille du ADNc:1452bp
Description du ADNc:Full length Clone DNA of Homo sapiens AHNAK nucleoprotein 2 DNA.
Synonyme du gène:C14orf78
Espèces:Human
Vecteur:pCMV3-untagged
Plasmid:
Site de restriction:
Séquence du marqueur:
Description de la séquence:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Humain AHNAK2/AHNAK nucleoprotein 2 expression plasmide de Gène l'ADNc ORF clone on other vectors
Humain AHNAK2/AHNAK nucleoprotein 2 expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurHG15220-ACGCHF270
Humain AHNAK2/AHNAK nucleoprotein 2 expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurHG15220-ACRCHF270
Humain AHNAK2/AHNAK nucleoprotein 2 expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurHG15220-ANGCHF270
Humain AHNAK2/AHNAK nucleoprotein 2 expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurHG15220-ANRCHF270
Humain AHNAK2/AHNAK nucleoprotein 2 expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG15220-CFCHF230
Humain AHNAK2/AHNAK nucleoprotein 2 expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurHG15220-CHCHF230
Humain AHNAK2/AHNAK nucleoprotein 2 expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurHG15220-CMCHF230
Humain AHNAK2/AHNAK nucleoprotein 2 expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurHG15220-CYCHF230
Humain AHNAK2/AHNAK nucleoprotein 2 Gène ADNc clone le vecteur de clonageHG15220-GCHF90
Humain AHNAK2/AHNAK nucleoprotein 2 expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurHG15220-NFCHF230
Humain AHNAK2/AHNAK nucleoprotein 2 expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurHG15220-NHCHF230
Humain AHNAK2/AHNAK nucleoprotein 2 expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurHG15220-NMCHF230
Humain AHNAK2/AHNAK nucleoprotein 2 expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurHG15220-NYCHF230
Humain AHNAK2/AHNAK nucleoprotein 2 expression plasmide de Gène l'ADNc ORF cloneHG15220-UTCHF230
 En savoir plus sur les vecteurs d'expression
Product nameProduct name
Size / Price
Catalogue : HG15220-UT
Prix catalogue : 
Prix :      (You Save: )
Taille :
Quantité :+-
Disponibilité2-3 weeks
Bulk Discount RequiryAjouter au panier
Contact Us
Images
      Articles consultés récemment
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »