Commande rapide

Humain Aryl Hydrocarbon Receptor expression plasmide de Gène l'ADNc ORF clone, C-His Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Human AHR Informations sur les produits clonés de cDNA
Taille du ADNc:2547bp
Description du ADNc:Full length Clone DNA of Homo sapiens aryl hydrocarbon receptor with C terminal His tag.
Synonyme du gène:AHR
Site de restriction:KpnI + NotI (6kb + 2.59kb)
Séquence du marqueur:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Description de la séquence:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Human AHR Gene Plasmid Map
Human AHR ORF mammalian expression plasmid, C-His tag
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Humain Aryl Hydrocarbon Receptor expression plasmide de Gène l'ADNc ORF clone, C-His Marqueur on other vectors
Humain Aryl Hydrocarbon Receptor expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurHG10456-ACGCHF390
Humain Aryl Hydrocarbon Receptor expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurHG10456-ACRCHF390
Humain Aryl Hydrocarbon Receptor expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurHG10456-ANGCHF390
Humain Aryl Hydrocarbon Receptor expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurHG10456-ANRCHF390
Humain Aryl Hydrocarbon Receptor expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG10456-CFCHF350
Humain Aryl Hydrocarbon Receptor expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurHG10456-CHCHF350
Humain Aryl Hydrocarbon Receptor expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurHG10456-CMCHF350
Humain Aryl Hydrocarbon Receptor expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurHG10456-CYCHF350
Humain Aryl Hydrocarbon Receptor Gène ADNc clone le vecteur de clonageHG10456-MCHF90
Humain Aryl Hydrocarbon Receptor expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurHG10456-NFCHF350
Humain Aryl Hydrocarbon Receptor expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurHG10456-NHCHF350
Humain Aryl Hydrocarbon Receptor expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurHG10456-NMCHF350
Humain Aryl Hydrocarbon Receptor expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurHG10456-NYCHF350
Humain Aryl Hydrocarbon Receptor expression plasmide de Gène l'ADNc ORF cloneHG10456-UTCHF350
 En savoir plus sur les vecteurs d'expression
Product nameProduct name
Size / Price
Catalogue : HG10456-CH
Prix catalogue : 
Prix :      (You Save: )
Taille :
Quantité :+-
DisponibilitéIn Stock
Bulk Discount RequiryAjouter au panier
Contact Us
  • Human AHR ORF mammalian expression plasmid, C-His tag
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.