Commande rapide

Humain IBA1/AIF1 expression plasmide de Gène l'ADNc ORF clone

  • Human AIF1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Fiche techniqueCommentairesProduits apparentésProtocoles
Humain AIF1 Informations sur les produits clonés de cDNA
Gene_bank_ref_id:BC009474
Taille du ADNc:444bp
Description du ADNc:Full length Clone DNA of Homo sapiens allograft inflammatory factor 1.
Synonyme du gène:DADB-70P7.8, AIF-1, IBA1, IRT-1, IRT1, AIF1
Espèces:Human
Vecteur:pCMV3-untagged
Plasmid:pCMV3-AIF1
Site de restriction:KpnI + XbaI (6.1kb + 0.44kb)
Séquence du marqueur:
Description de la séquence:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with AIF1 qPCR primers for gene expression analysis, HP102877 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicillin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Humain AIF1 Gene Plasmid Map
Human AIF1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Product nameProduct name
Fond

AIF1, also known as IBA1, is an actin-binding protein. AIF1 is expressed selectively in human macrophage-like cell lines, and in a subset of CD68(+) macrophages in the interstitial and perivascular spaces of human heart allografts. It is expressed in macrophages and neutrophils. AIF1 enhances membrane ruffling and RAC activation. AIF1 enhances the actin-bundling activity of LCP1. It also enhances lymphocyte migration. AIF1 may play a role in macrophage activation and function. It binds calcium and plays a role in RAC signaling and in phagocytosis. It promotes the proliferation of vascular smooth muscle cells and of T-lymphocytes.

Size / Price
Catalogue : HG14227-UT
Prix catalogue : 
Prix :      (You Save: )
Taille :
Quantité :+-
Disponibilité
Ajouter au panierBulk Discount Requiry

Datasheet & Documentation

Contact Us
    Articles consultés récemment
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »