AK2 cDNA ORF Clone, Human, C-HA tag

Price:
Size:
Number:

AK2 cDNA ORF Clone, Human, C-HA tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
720 bp
Description
Full length Clone DNA of Human adenylate kinase 2 with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

AK2 cDNA ORF Clone, Human, C-HA tag: Alternative Names

ADK2 cDNA ORF Clone, Human; AK2 cDNA ORF Clone, Human

AK2 Background Information

Adenylate kinase 2 (AK2) belongs to the Adenylate kinase family that contains three isozymes: AK1, AK2 and AK3. Adenylate kinases are involved in regulating the adenine nucleotide composition within a cell by catalyzing the reversible transfer of phosphate groups among adenine nucleotides. Adenylate kinase2 (AK2) is expressed in mitochondrial intermembrane space. It may play a role in apoptosis. It has been demonstrated that in apoptotic cells AK2 was translocated into the cytosol concomitantly with cytochronme C. Mutations in this gene are the cause of reticular dysgenesis. These mutations result in absent or strongly decreased protein expression. It has been also established that AK2 is specifically expressed in the stria vascularis region of the inner ear, which provides an explanation of the sensorineural deafness in these individuals.
Full Name
adenylate kinase 2
References
  • Lagresle-Peyrou C, et al. (2008) Human adenylate kinase 2 deficiency causes a profound hematopoietic defect associated with sensorineural deafness. Nature Genetics. 41: 106-11.
  • Bruns GA, et al. (1977) Adenylate kinase 2, a mitochondrial enzyme. Biochem Genet. 15 (5-6): 477-86.
  • Khler C, et al. (1999) Release of adenylate kinase 2 from the mitochondrial intermembrane space during apoptosis. FEBS Lett. 447 (1): 10-2.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait