After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Humain AK4 / Adenylate Kinase 4 / AK3L1 expression plasmide de Gène l'ADNc ORF clone, N-His Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Human AK4 Informations sur les produits clonés de cDNA
Gene_bank_ref_id:BC016180
Taille du ADNc:672bp
Description du ADNc:Full length Clone DNA of Homo sapiens adenylate kinase 4 with N terminal His tag.
Synonyme du gène:AK3, AK3L1, AK3L2
Espèces:Human
Vecteur:pCMV3-N-His
Plasmid:
Site de restriction:
Séquence du marqueur:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Description de la séquence:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Humain AK4 / Adenylate Kinase 4 / AK3L1 expression plasmide de Gène l'ADNc ORF clone, N-His Marqueur on other vectors
Humain AK4 / Adenylate Kinase 4 / AK3L1 expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurHG12406-ACGCHF270
Humain AK4 / Adenylate Kinase 4 / AK3L1 expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurHG12406-ACRCHF270
Humain AK4 / Adenylate Kinase 4 / AK3L1 expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurHG12406-ANGCHF270
Humain AK4 / Adenylate Kinase 4 / AK3L1 expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurHG12406-ANRCHF270
Humain AK4 / Adenylate Kinase 4 / AK3L1 expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG12406-CFCHF230
Humain AK4 / Adenylate Kinase 4 / AK3L1 expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurHG12406-CHCHF230
Humain AK4 / Adenylate Kinase 4 / AK3L1 expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurHG12406-CMCHF230
Humain AK4 / Adenylate Kinase 4 / AK3L1 expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurHG12406-CYCHF230
Humain AK4 / Adenylate Kinase 4 / AK3L1 Gène ADNc clone le vecteur de clonageHG12406-GCHF90
Humain AK4 / Adenylate Kinase 4 / AK3L1 expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurHG12406-NFCHF230
Humain AK4 / Adenylate Kinase 4 / AK3L1 expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurHG12406-NHCHF230
Humain AK4 / Adenylate Kinase 4 / AK3L1 expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurHG12406-NMCHF230
Humain AK4 / Adenylate Kinase 4 / AK3L1 expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurHG12406-NYCHF230
Humain AK4 / Adenylate Kinase 4 / AK3L1 expression plasmide de Gène l'ADNc ORF cloneHG12406-UTCHF230
 En savoir plus sur les vecteurs d'expression
Product nameProduct name
Fond

Adenylate kinase isoenzyme 4, mitochondrial, also known as ATP-AMP transphosphorylase, Adenylate kinase 3-like, AK4 and AK3L1, is a member the adenylate kinase family. AK4 / AK3L1 is localized to the mitochondrial matrix. Adenylate kinases regulate the adenine and guanine nucleotide compositions within a cell by catalyzing the reversible transfer of phosphate group among these nucleotides. Five isozymes of adenylate kinase have been identified in vertebrates. Expression of these isozymes is tissue-specific and developmentally regulated. AK4 / AK3L1 catalyzes the reversible transfer of the terminal phosphate group between ATP and AMP. It may also be active with GTP. Adenylate kinase 4 ( AK4 / AK3L1 ) is a unique member with no enzymatic activity in the adenylate kinase (AK) family although it shares high sequence homology with other AKs. It remains unclear what physiological function AK4 might play or why it is enzymatically inactive. AK4 / AK3L1 retains the capability of binding nucleotides. It has a glutamine residue instead of a key arginine residue in the active site well conserved in other AKs. The enzymatically inactive AK4 is a stress responsive protein critical to cell survival and proliferation. AK4 / AK3L1 is likely that the interaction with the mitochondrial inner membrane protein ANT is important for AK4 to exert the protective benefits to cells under stress. AK4 / AK3L1 also acts on the specific mechanism of energy metabolism rather than control of the homeostasis of the ADP pool ubiquitously.

Size / Price
Catalogue : HG12406-NH
Prix catalogue : 
Prix :      (You Save: )
Taille :
Quantité :+-
Disponibilité2-3 weeks
Bulk Discount RequiryAjouter au panier
Contact Us
Images
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »