Commande rapide

Humain AKT1S1/PRAS40 transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, N-His Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Humain AKT1S1 Informations sur les produits clonés de cDNA
Taille du ADNc:771bp
Description du ADNc:Full length Clone DNA of Homo sapiens AKT1 substrate 1 (proline-rich), transcript variant 2 with N terminal His tag.
Synonyme du gène:AKT1S1, Lob, PRAS40, MGC2865
Site de restriction:
Séquence du marqueur:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Description de la séquence:
( We provide with AKT1S1 qPCR primers for gene expression analysis, HP100175 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Humain AKT1S1/PRAS40 transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, N-His Marqueur on other vectors
Humain AKT1S1/PRAS40 transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurHG10092-ACGCHF270
Humain AKT1S1/PRAS40 transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurHG10092-ACRCHF270
Humain AKT1S1/PRAS40 transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurHG10092-ANGCHF270
Humain AKT1S1/PRAS40 transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurHG10092-ANRCHF270
Humain AKT1S1/PRAS40 transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG10092-CFCHF230
Humain AKT1S1/PRAS40 transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurHG10092-CHCHF230
Humain AKT1S1/PRAS40 transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurHG10092-CMCHF230
Humain AKT1S1/PRAS40 transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurHG10092-CYCHF230
Humain AKT1S1/PRAS40 transcript variant 2 Gène ADNc clone le vecteur de clonageHG10092-MCHF90
Humain AKT1S1/PRAS40 transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG10092-M-FCHF230
Humain AKT1S1/PRAS40 transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurHG10092-NFCHF230
Humain AKT1S1/PRAS40 transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurHG10092-NHCHF230
Humain AKT1S1/PRAS40 transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurHG10092-NMCHF230
Humain AKT1S1/PRAS40 transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurHG10092-NYCHF230
Humain AKT1S1/PRAS40 transcript variant 2 expression plasmide de Gène l'ADNc ORF cloneHG10092-UTCHF230
 En savoir plus sur les vecteurs d'expression
Product nameProduct name
Size / Price
Catalogue : HG10092-NH
Prix catalogue : 
Prix :      (You Save: )
Taille :
Quantité :+-
Ajouter au panierBulk Discount Requiry
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.