After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Commande rapide

Text Size:AAA

Humain AKT1S1/PRAS40 transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, N-His Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Human AKT1S1 Informations sur les produits clonés de cDNA
Gene_bank_ref_id:NM_001098632.1
Taille du ADNc:771bp
Description du ADNc:Full length Clone DNA of Homo sapiens AKT1 substrate 1 (proline-rich), transcript variant 2 with N terminal His tag.
Synonyme du gène:AKT1S1, Lob, PRAS40, MGC2865
Espèces:Human
Vecteur:pCMV3-N-His
Plasmid:
Site de restriction:
Séquence du marqueur:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Description de la séquence:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Humain AKT1S1/PRAS40 transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, N-His Marqueur on other vectors
Humain AKT1S1/PRAS40 transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurHG10092-ACGCHF270
Humain AKT1S1/PRAS40 transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurHG10092-ACRCHF270
Humain AKT1S1/PRAS40 transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurHG10092-ANGCHF270
Humain AKT1S1/PRAS40 transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurHG10092-ANRCHF270
Humain AKT1S1/PRAS40 transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG10092-CFCHF234
Humain AKT1S1/PRAS40 transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurHG10092-CHCHF234
Humain AKT1S1/PRAS40 transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurHG10092-CMCHF234
Humain AKT1S1/PRAS40 transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurHG10092-CYCHF234
Humain AKT1S1/PRAS40 transcript variant 2 Gène ADNc clone le vecteur de clonageHG10092-MCHF90
Humain AKT1S1/PRAS40 transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG10092-M-FCHF234
Humain AKT1S1/PRAS40 transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurHG10092-NFCHF234
Humain AKT1S1/PRAS40 transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurHG10092-NHCHF234
Humain AKT1S1/PRAS40 transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurHG10092-NMCHF234
Humain AKT1S1/PRAS40 transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurHG10092-NYCHF234
Humain AKT1S1/PRAS40 transcript variant 2 expression plasmide de Gène l'ADNc ORF cloneHG10092-UTCHF234
 En savoir plus sur les vecteurs d'expression
Product nameProduct name
Size / Price
Catalogue : HG10092-NH
Prix catalogue : 
Prix :      (You Save: )
Taille :
Quantité :+-
Disponibilité2-3 weeks
Bulk Discount RequiryAjouter au panier
Contact Us
Images
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »