Commande rapide

Text Size:AAA

Human ALDH1A1 ORF mammalian expression plasmid, N-His tag

Fiche techniqueCommentairesProduits apparentésProtocoles
Human ALDH1A1 Informations sur les produits clonés de cDNA
Taille du ADNc:1506bp
Description du ADNc:Full length Clone DNA of Homo sapiens aldehyde dehydrogenase 1 family, member A1 with N terminal His tag.
Synonyme du gène:ALDC, ALDH1, PUMB1, ALDH11, RALDH1, ALDH-E1, MGC2318, ALDH1A1
Site de restriction:
Séquence du marqueur:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Description de la séquence:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name

Aldehyde dehydrogenase 1 family, member A1 (ALDH1A1), also known as Aldehyde dehydrogenase 1 (ALDH1), or Retinaldehyde Dehydrogenase 1 (RALDH1), is an enzyme that is expressed at high levels in stem cells and that has been suggested to regulate stem cell function. The retinaldehyde dehydrogenase (RALDH) subfamily of ALDHs, composed of ALDH1A1, ALDH1A2, ALDH1A3, and ALDH8A1, regulate development by catalyzing retinoic acid biosynthesis. The ALDH1A1 protein belongs to the aldehyde dehydrogenases family of proteins. Aldehyde dehydrogenase is the second enzyme of the major oxidative pathway of alcohol metabolism. ALDH1A1 also belongs to the group of corneal crystallins that help maintain the transparency of the cornea. Increased ALDH1A1 activity has been found in the stem cell populations of leukemia and some solid tumors. In tumor specimens, increased ALDH1A1 immunopositivity was found not only in secretory type cancer epithelial cells but also in neuroendocrine tumor populations. ALDH1 has been identified as a reliable marker of breast cancer stem cells. ALDH1 expression in primary cancer is an independent prognostic factor in node-positive breast cancer patients. ALDH1A1 plays a key role in normal hematopoiesis, and as a TLX1 transcriptional target, ALDH1A1 may contribute to the ability of this homeoprotein to alter cell fate and induce tumor growth.

  • Li T, et al. (2010). ALDH1A1 is a marker for malignant prostate stem cells and predictor of prostate cancer patients' outcome. Lab Invest. 90(2): 234-44.
  • Levi BP, et al. (2009) Aldehyde dehydrogenase 1a1 is dispensable for stem cell function in the mouse hematopoietic and nervous systems. Blood. 113(8): 1670-80.
  • Rahman FB, et al. (2006) Uncompetitive inhibition of Xenopus laevis aldehyde dehydrogenase 1A1 by divalent cations. Zoolog Sci. 23(3): 239-44.
  • Jester JV, et al. (1999). The cellular basis of corneal transparency: evidence for corneal crystallins. J Cell Sci. 112 ( Pt 5): 613-22.
  • Size / Price
    Catalogue : HG11388-NH
    Prix catalogue :   (Save )
    Prix :      [How to order]
     Instructions d’expédition
        Articles consultés récemment
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.